Reagents
Chlorpheniramine maleate (National Pharmaceutical Group Rongsheng Pharmaceutical Co., Ltd., China) was dissolved in dimethyl sulfoxide (DMSO) and then stored at -20℃. For all samples, the final DMSO concentration was kept at 0.1%.
Cell culture
Human adult dermal fibroblasts (DFs) and primary keloid fibroblasts (KFs) received the culture as described. The use of human samples (keloid tissue and normal tissue) was conducted by complying with a protocol reviewed and approved by the Human Research Ethics Committee of the Second Affiliated Hospital of Zhejiang University School of Medicine. In brief, keloid fibroblasts originated from earlobe keloid tissue resulting from ear piercing in three patients aged from 20 to 30 (two females and one male). Normal dermal fibroblasts were acquired from the back skin of the three patients in their thirties (two females and one male) without systematic diseases when they were undergoing other unrelated operations. DFs and KFs were maintained in Dulbecco’s modified Eagle’s medium (DMEM; Gibco, CA, USA) containing 10% Fetal Bovine Serum (FBS, Gibco, CA, USA), 100 U/ml penicillin and 100 μg/ml streptomycin. Furthermore, cells were grown in a humidified atmosphere of 5% CO2 at 37 ℃. The culture medium was changed per 3 days. Moreover, all experiments were performed after 3 to 4 cell passages.
Cell proliferation assay
The primary KFs and human adult DFs were seeded in 96-well plates with 5000 cells per well along with 100 μl of medium, respectively. KFs and DFs, after being starved in serum-free medium for 24h to allow for cell synchronization, were replaced with fresh culture medium in the absence or presence of different doses of CPM (0.01, 0.05, 0.10, 0.15, 0.30mM), and then tested by employing a cell counting kit-8 (CCK-8; Lianke Biological, China) at 24h and 48h. In brief, at each testing time point, 10 μl of sterile CCK-8 solution was introduced to each well and then incubated for 1h at 37 °C, and then the medium was harvested to measure the optical density (OD) values at 450 nm by using a micro-plate reader (Thermo Scientific). To be specific, cell proliferation rate (%) = OD value of the experimental group/OD value of the control group 100%. On the whole, all the assays were performed in quintuplicate and then repeated by applying three cell samples.
Apoptosis assay
The experimental concentration was further taken by complying with the results of IC50. The two cells were cultured according to the growing conditions and the groups described above. Subsequently, the cells were detached with 0.25% trypsin/0.01% EDTA (Gibco) and then washed with cold PBS for three times. Next, the cells were re-suspended in 1x annexin-binding buffer to 1x106 cells/ml and then stained with 100 ml binding buffer containing 5 ml Annexin V (Beyotime Biotechnology) for 15 min and 1 ml of 100 mg/ml PI for additional 5 min at ambient temperature. Cells were analyzed using FACS Caliber (BD biosciences). The results were analyzed with Flowjo software (BD biosciences).
Cell cycle analysis
As indicated from the result of CCK-8 and Apoptosis assay, 0.15 mM CPM could inhibit proliferation of KFs and promote KFs apoptosis, while 0.15 mM CPM did not induce mass death of KFs. Thus, 0.15mM CPM was employed for the following experiment.
Cell cycle analysis was performed to evaluate the effect of CPM on KFs. In brief, KFs and DFs were cultured for 48h without or with CPM at a concentration of 0.15 mM, respectively. Subsequently, the cells were trypsinized, centrifuged at 1500 rpm for 5 min, washed with ice-cold PBS and then suspended in PBS containing 1 ml DNA Staining solution and permeabilization solution. The samples were incubated at ambient temperature for 30 min, and flow cytometric analyses were conducted with a flow cytometer (Beckman Coulter) equipped with Flowjo software (TreeStar). The mentioned analyses were repeated in four cell samples.
Cell migration assay
An in vitro scratch wound assay was performed to evaluate cell migration. For the in vitro wound assay, KFs and DFs, when reaching 90 % confluence in 6-well plates, were scratched with a sterile 200-μl pipette tip and then incubated in the culture medium with or without 0.15 mM CPM. The cell status was recorded for 0 h after the scratching process. The serum free medium was replaced and then photographed after 48h. Besides, photographs were taken before and after the scratching and at the indicated time point. The photographed area was quantified with computer-assisted image analysis with IPP 6.0 software.
Quantitative real time qPCR analysis
To analyze the effect of CPM to the mRNA levels of TGF-β1, JAK1, STAT3 and Ki-67 in DFs and KFs, RT-PCR were performed (Table 1). In brief, after 48h of incubation with or without CPM (0.15 mM) in serum-free culture medium, total mRNA was extracted by using RNA Rapid Extraction Kit (Generay) and then reverse transcribed to cDNA with PrimeScript™ RT reagent Kit (Takara, Japan). In addition, RT-PCR was performed by using ChamQ SYBR Color qPCR Master Mix (Vazyme) based on CFX connect Real-Time PCR System (Bio-Rad). With the standard 2-△△Ct method, the mRNA expressions of Target genes were normalized to GAPDH and calculated.
Table 1
Primer sequences for RT-qPCR
Gene
|
Primer
|
Sequence (5’ - 3’)
|
TGF-β1
|
Forward
|
CAGTACAGCAAGGTCCTTGC
|
Reverse
|
ACGTAGTAGACGATGGGCAG
|
JAK1
|
Forward
|
GCATCGAGCGCACAAAGTTA
|
Reverse
|
GTGATGGTGCGATTTGGAGC
|
STAT3
|
Forward
|
CAAGGGCTTCTCCTTCTGGG
|
Reverse
|
CCTGGGTCAGCTTCAGGATG
|
Ki-67
|
Forward
|
TTACCGGGCGGAGGTATGAA
|
Reverse
|
ACGTCCAGCATGTTCTGAGG
|
GAPDH
|
Forward
|
GCTCTCTGCTCCTCCTGTTC
|
|
Reverse
|
GACTCCGACCTTCACCTTCC
|
Western blot assay
DFs and KFs were seeded on six well plated, cultured overnight, and treated with CPM for 48h. Then Cells were lysed in RIPA containing 1% protease inhibitors (Solarbio, Beijing). Different groups of protein concentration were measured by BCA Protein Assay Kit (Beyotime, China). The protein of each sample was separated on 10% SDS-PAGE gels and transferred to PVDF membranes (Millipore, IPVH00010) at 300 mA V for 90 min. After blocking in 5% nonfat milk for 1 h at room temperature, the membranes were incubated with primary antibodies against TGF-β (1:1000; Abcam, ab179695), JAK1 (1:1500; Abcam, ab133666), STAT3 (1:2000; Abcam, ab68153) and Ki67 (1:1000; Abcam, ab243878) overnight, and GAPDH (1:5000; Abcam, ab8245) was used as a control. Next, after washing with TBST for three times, the membranes were incubated with Goat anti-Rabbit IgG(H+L)Secondary antibody (1:5000; Thermo Pierce, 31210) for 1 h at room temperature. Finally, according to instruction of Super Signal® West Dura Extended Duration Substrate, the membranes were detected using enhanced chemiluminescent (ECL). Band Scan 5.0 software was used to quantify the density of protein bands.
Animal model study design
The experimental procedures were approved by the Ethics Committee of the Second Affiliated Hospital of Zhejiang University School of Medicine (Approval number: 2020-948, Date: 2020/12/18, Hangzhou, China). A total of 18 animals were treated by complying with the facility's guidelines for laboratory animal treatment and care. Human keloid fragments were acquired from three surgically treated patients. Next, each human keloid fragment was split into multiple small specimens (0.5*0.5cm with full thickness), soaked in ice PBS and then processed in 2 h. After the general anesthesia of the nude mice (BALB/nu-nu; SLAC Laboratory Animal Company, Shanghai, China) was achieved, a 0.5*0.5cm full-thickness skin was excised on backs of the nude mice, specimens were subcutaneously sutured and then fixed on the backs of nude athymic mice, with two specimens in the respective mouse. One week later, 18 mice with all the keloid scar tissues on the back were selected to perform the next experiment. From day 8, drugs were injected once a week. The specimens in the respective mouse fell to two study groups, i.e., control group, 0.9% normal saline (100 μl/site) and experimental group, CPM (Volume ratio 6%, 0.6mg/ml, 100ul/site). All mice were euthanized on day 56, anesthetized with chloroform and separated by guillotine. The volume ratio change of the back keloid was measured, and scar samples were collected for histology and immunohistochemistry. All of the animal experiments in this study were performed in accordance with the National Institutes of Health Guide for Care and Use of Laboratory Animals, and were approved by the laboratory animal ethical committee of Zhejiang University.
Keloid Tissue Weight
Five weeks after the implantation, the keloids were harvested from the backs of the mice. The weight variation of the explanted keloids was compared between the treatment and control groups.
Histology and immunofluorescence
Furthermore, the samples were fixed in 4% paraformaldehyde for 48 h, dehydrated through an alcohol gradient and then embedded in paraffin blocks. Five-micron-thick histological sections were cut at the center of the embedded specimens and then stained with Hematoxylin and Eosin (H&E) and Masson. The sections were observed under an optical microscope, and the images were captured with an inverted microscope (Leica, German). For immunohistochemistry, skin sections were dewaxed and then pretreated with antigen retrieval solution. Next, the sections were stained with TGFβ1 antibody (Sc-146), Ki-67 antibody (27309-1-AP), Stat3 antibody (4904S), JAK1 antibody (ET1705-84) and further incubated with Enzyme-labeled goat anti-mice/rabbit IgG polymer covered tissue in the histochemistry kit (Fuzhou Maixin Bio). Afterwards, the color was rendered with DAB (Shanghai Gene), and counterstained nucleus with Hematoxylin for about 4minbefore was observed under an inverted fluorescence microscope (Leica, German).VS2000 scanning system was used to collect images, and Image J was employed for the analysis.
Statistical analysis
Triplicate experiments were performed. All quantitative data with normal distribution were expressed as mean ± standard deviation. Comparisons among multiple groups were drawn by conducting one-way analysis of variance (ANOVA) and then Tukey post hoc multiple comparisons test. For the comparisons between two groups, the analyses were conducted by Student’s t test. P<0.05 was considered with statistical significance. All statistical analyses were conducted with GraphPad Prism 6.0 software.