Cell culture
NE-4C (Procell CL-0660) were provided by Procell Life Science & Technology Co.,Ltd. (Wuhan, China). Mouse NSCs were grown in Dulbecco’s minimal essential medium with high glucose (DMEM), supplemented with 10% fetal bovine serum. Cells were cultured according to culture method guidelines and incubated at 37°C, 5% CO2. NE-4C cells were dissociated with 0.05% trypsin-EDTA and resuspended in the incubator supplemented DMEM described above. Cells from passage levels 4–5 were used in the present study. The cell culture medium was refreshed every 1-2 days.
Cell proliferation test
To investigate the possible impact of rESWT on the viability/proliferation of NE-4C cells, different doses of rESWT (from 1.0 bar to 1.6bar, 500 impulses, and 2 Hz) were used in the cultures. The proliferation of NE-4C cells was analyzed by Cell Counting Kit-8 (CCK 8, Sevenbio, Beijing, China) proliferation assay. After being treated with rESWT, 5 × 103 cells were seeded into 96-well plates to grow for 12h, 24h, 36h, 48h, 60h, and 72 h. Then, 10 µL of CCK 8 was added to each well, and culture plates were incubated at 37°C for 1 h. The absorbance was measured by photometry at 450 nm. We chose 1.5 bar, 500 impulses, 2 Hz as a therapeutic dose.
rESWT treatment
To evaluate the influence on cell proliferation in vitro, rESWT (R15 transmitter,STORZ MEDICAL AG, Switzerland) was applied to the cultures at a dose of 1.5 bar, 500 impulses, and 2 Hz, which maximized the therapeutic effects without significant reduction of the cell viability. NE-4C cells were dissociated with 0.05% trypsin-EDTA and resuspended in the tube supplemented DMEM described above. Transferred the cell suspension filled with the complete medium to a 2mL EP tube. After removing the air in the tube, then embedded the EP tube into a 50mL centrifuge tube filled with coupling agent. Coupling was used to minimize the loss of shock wave energy at the interface between the transmitter and tube. The transmitter of rESWT acted vertically on the upper part (Figure 1A-C). The control group was maintained under the same culture conditions, but without rESWT exposure.
Cell transfection
The mimic targeting let 7b and the negative control were obtained from General Biol Co., Ltd. (Anhui, China). The NEAT1 overexpression plasmid vector was constructed by HanBio Co., Ltd. (Shanghai, China). Transient transfection of mimics (100nM) and plasmid vector (10 nM) was performed using Lipofectamine 2000 (Thermo Fisher, CA, USA) according to the manufacturer’s instructions. The empty vector and negative control of siRNA were also used as control. Transfected cells were harvested at 48 h after transfection for subsequent analysis and detection.
Experiment grouping
To explore whether NEAT1 mediates rESW regulation of NSCs proliferation, we divided the experiment groups into blank control group(Control), negative control group (Blank, plasmid, BP), overexpressing lncRNA NEAT1 (NEAT1) group, shock wave treatment group (rESW), shock wave + negative control group (rESW+BP), shock wave + overexpressing lncRNA NEAT1 group (rESW+NEAT1). Similarly, for let 7b, we divided the experiment groups into: blank control group༈Control༉, negative control group (negative mimic, NM), shock wave treatment group (rESW), shock wave + negative control group (rESW+NM), shock wave + overexpression let 7b group (rESW+let 7b).
Quantitative real-time PCR
Total RNA was isolated from the NE-4C using TRIzol (TransGen Biotech, Beijing, China) according to the manufacturer’s instructions. Then, 1 µg of total RNA was used for reverse transcription using a One-Step gDNA Removal and cDNA Synthesis SuperMix (TransGen Biotech) according to manufacturer’s instructions. Green qPCR SuperMix (TransGen Biotech) was used to qualify the expression levels of Nestin, Cyclin D1, and P21. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) and β-actin were respectively used as endogenous controls (Sangong Biotech, Shanghai, China). Next, quantitative RT-PCR was performed using mmu-miR-let 7b-specific probes and specific gene primers (Sangong Biotech, Shanghai, China). All qRT-PCR reactions were performed using the Step ONE Plus RT-PCR System (Applied Biosystems, USA). The relative quantification 2-ΔΔCt method was applied to calculate the gene expression values. Primers and probes used in this study are shown in Table 1.
Table 1 Primers and probes used in this study
Neat1-F
|
5′- GGCAGGTCTAGTTTGGGCAT-3′
|
Neat1-R
|
5′- CCTCATCCCTCCCAGTACCA-3′
|
let 7b-F
|
5′-GCGCGCTATACAACCTACTGC-3′
|
let 7b-R
|
5′- AGTGCAGGGTCCGAGGTATT -3′
|
Nestin-F
|
5'-CAACCACAGGAGTGGGAACT-3'
|
Nestin-R
|
5'-TCTGGCATTGACTGAGCAAC-3'
|
P21-F
|
5'-CCTGGTGATGTCCGACCTG-3'
|
P21-R
|
5'-CCATGAGCGCATCGCAATC-3'
|
Cyclin D1-F
|
5′-CAGACCTCTTAACCTTATAG-3′
|
Cyclin D1-R
|
5′-TTCCCAAGCACCTCATACTACCAGC- 3′;
|
Western Blot
Total protein was extracted from cells using ice-cold radioimmunoprecipitation assay (RIPA) buffer (Sevenbio, Beijing, China) supplemented with protease inhibitors (10 mg/mL aprotinin, 10 mg/mL phenyl-methylsulfonyl fluoride [PMSF], and 50 mM sodium orthovanadate). The BCA protein assay kit (Beyotime Institute of Biotechnology) was used to determine the protein concentration of the supernatant. Equal amounts of protein samples (30 µg) were separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and electrically transferred onto polyvinylidene difluoride (PVDF) membrane (Millipore, Shanghai, China). Non-specific binding was blocked by incubation with 5% fat-free milk in Tris-buffered saline containing 0.1% Tween-20 (TBST) at room temperature for two hours.
The membranes were subsequently incubated with primary antibodies as follows: Nestin (1:500; Proteintech, Chicago, IL, USA), P21 (1:500; Proteintech), Cyclin D1 (1:5000; Proteintech), and GAPDH (1:3000; Affinity, Cincinnati, OH, USA) at 4°C overnight. The membranes were washed and incubated with HRP-conjugated secondary antibodies (Sevenbio, Beijing, China), diluted at 1:3000 at room temperature for two hours. Immunoblots were visualized using an enhanced chemiluminescence kit (ECL; Sevenbio, Beijing, China) and detected by Bio-Rad Chemi-Doc (Bio-Rad, CA, USA) and then normalized to that of GAPDH or β-actin.
Immunofluorescence staining
Add BrdU working solution one hour before cell fixation. Cells grown on coverslips were fixed with 4% paraformaldehyde, followed by treatment with 0.1 M glycine for 20 min at 25°C and 0.1% Triton X-100 for additional 5 min at 25°C to permeabilize. Cells were then incubated alternatively with the following primary antibodies: Nestin (1:500, Abcam, USA), Brdu (1:200, Abcam, USA), The primary antibodies were washed with PBS, and the cells incubated with goat anti-rat IgG-Dylight 594 (1:100 in PBS; A23440, Amylet Scientific, Wuhan, China) and goat anti-rabbit IgG-FITC (1:150; Abcam, USA) for 30 min at 25°C. The cell nuclei were counterstained with Hoechst 33342 (1:500; C0030, Solarbio, Beijing, China). Coverslips were finally mounted with Mowiol in PBS for observation. Images were taken with an Olympus BX51 microscope. Observations were made in 10 microscopic fields randomly taken from three different experiments.
Statistical analysis
Quantitative data were presented as mean ± standard deviation (SD). GraphPad Prism 8 (GraphPad, La Jolla, CA, USA) software was used for statistical analysis. Student’s t-test (two-tailed), one-way ANOVA or two-way ANOVA was employed to evaluate all statistical analyses. Differences were considered statistically significant when P < 0.05.