Cells and their propagation
Adherent Syrian hamster BHK 21 cells and suspension-adapted BHK 21 C13-2P cells (European Collection of Cell Cultures, catalogue number 84111301) were both cultured in G-MEM supplemented with 10% fetal calf serum, 1,5 g/L bacto tryptose phosphate and 40 mg/L gentamicin.
Plasmids for the construction of virus recombinants
The pKoom plasmid used to generate the MVA-Koom virus was constructed from pGP-GNR, pRSET-mCherry and pVote2 kindly provided by James Jancovich, Jean-Marie Garnier and Bernard Moss respectively (supplementary figure 2). The BioBrick strategy was set up as follows. Twin TEV cleavage sites, purification tags (10His, Flag10His, 10HisFlag, TwinStrep, FlagTwinStrep and TwinStrepFlag) fused to a P3C cleavage site (Supplementary figure 3A), and primers were purchased from Sigma. Synthetic DNA encoding the HIV-1 codon modified IN, LEDGF and YFP were purchased from GeneArt or GeneScript respectively. PCR was used to amplify TEV, APOBEC3G, CBFβ, EloB, EloC, HIV-1 Vif and IN (pNL4.3) with the primers listed (Supplementary figure 3B). Translational stop signals were removed from all ORFs and replaced with a series of degenerate codons for twin TEV cleavage sites (Supplementary figure 3C) except the YFP stop codon. All ORFs were flanked at their 5’ end by EcoRI and XbaI sites and at their 3’ end by SpeI and PstI sites (Supplementary figure 3D) in order to carry out a reiterative BioBrick cloning strategy and assemble a polyprotein coding sequence [20]. Briefly, as schematically represented in supplementary figure 4, ORFs were prepared with EcoRI and PstI digestion and inserted into pUC19 that was digested with EcoRI and PstI, to generate a pUC_BB plasmid. Each pUC_BB was further linearised with SpeI and PstI to add a downstream BioBrick generated by XbaI and PstI restriction, or linearized with EcoRI and XbaI to add an upstream Biobrick generated by EcoRI and SpeI restriction. The polyprotein coding sequences were then removed from the pUC_BB constructs by XbaI and PstI digestion and inserted into the pENTR_BB-TEV-YFP digested with SpeI and PstI. Finally, the pENTR_BB plasmids were recombined with the pVote0GW plasmid using Gateway recombination to generate a plasmid for insertion of the polyprotein sequences into the MVA genome as previously described [2].
Selection and amplification of virus recombinants
To isolate the MVA-Koom virus 106 adherent BHK 21 cells were infected with MVA-T7 at about 2 PFU/cell and transfected in OptiMEM medium with 1 µg pKoom plasmid DNA using Lipofectamine 2000 (Thermo Fisher Scientific). Cells were frozen at -20°C one day later and subsequently freeze-thawed several times to release virus. MVA-Koom was selected by serial passage in the presence of 1 mg/ml G418 and visualization of mCherry positive plaques under a fluorescence microscope. To generate virus recombinants encoding genes under the control of the T7 promoter, 106 adherent BHK 21 cells were infected with MVA-Koom at about 2 PFU/cell and transfected as above. Cells were frozen at -20°C one day later and subsequently freeze-thawed several times to release virus. Released virus was diluted and used to infect fresh BHK 21 monolayers in the presence of 25 µg/ml mycophenolic acid, 15 µg/ml hypoxanthine and 250 µg/ml xanthine and/or 100 ng/ml coumermycin. Two days later, cell cultures were checked for green and red fluorescence using a fluorescence imaging system. This process was repeated several times in the presence of coumermycin only until all viral plaques displayed green fluorescence and no red fluorescence. At the end of the selection cycles, virus was amplified on BHK 21 cells in the absence of any selection pressure. Final virus stocks were prepared from infected cells displaying GFP expression within the entire cell culture as well as an overall cytopathic effect visible under a light microscope. Infected cells cultures were submitted to three cycles of freeze-thawing at -20° then centrifuged at 2000 g for 5 minutes. The supernatants were recovered, frozen at -20°C and used as crude virus stocks for protein expression experiments.
Protein production and purification
Medium scale protein production was carried out in adherent BHK 21 cells grown in 175 cm2 plastic bottles or in suspension BHK 21 C13-2P cells grown up to 1-1.5 106 cells/ml in cylindrical flasks submitted to orbital shaking. In the case of adherent cells, cell culture medium was removed and crude virus stocks were added to the cultures at about 2 PFU/cell for one hour incubation at 37°C. At this time, fresh medium containing 5-10% serum and 1 mM IPTG were added and incubation continued at 37° C for 24 hours. Infected cells were pelleted at 2000 g for 5 minutes, suspended in PBS and pelleted again at 2000 g for 5 minutes. Finally, the cell pellets were stored at -80° until their use for protein analysis or purification. GST-tagged proteins were purified from infected cell pellets using a batch resin method (Glutathione-Sepharose-4B) and a protocol provided by GE Healthcare.
For large scale production of proteins (Supplementary figure 1), suspension BHK 21 C13-2P cells (1-1.5 cells/ml) were infected as above with about 0.1 PFU/cell in 5 liters cylindrical flasks containing 1.2 liters of cell culture medium. Two days later, infected cells were mixed with uninfected cells at a 1:10 ratio in six 5 liters cylindrical flasks containing 1.5 to 2 liters of cell culture at 1-1.5 106 cells/ml. IPTG (1 mM final) was added at the time of cell mixture. Incubation at 37°C was pursued for another 24 hours. Cells were then pelleted and washed as above and the pellets stored at -80°C until use.
For purification of Twin-Strep tagged proteins (Vif/APOBEC complex), cell pellets were lysed by sonication in a buffer containing 50 mM Tris-HCl (pH8), 500 mM NaCl, 1mM EDTA, 10 mM CaCl2, 1mM MgCl2, 7 mM β mercaptoethanol, 0,5% tween 20 and a protease inhibitor cocktail. The lysates were then treated for one hour with RNAse and DNAse at 4°C. Insoluble proteins were removed by ultracentrifugation at 100,000 g and the supernatants obtained were filtered through 5µm and 0.2 µm cellulose membranes. Tagged proteins were then retained on a 1ml Strep Tactin column, washed in three successive steps (1 M NaCl, 1 mM EDTA, 50 mM Tris-HCl pH 8 then 150 mM NaCl, 1 mM EDTA, 100 mM Tris-HCl pH8 then 10 mM NaCl, 50 mM Tris-HCl pH8, 5% glycerol, 10 µM ZnCl2 and eluted with 5 mM desthiobiotin in 50 mM Tris-HCl pH 8, 10mM NaCl, 10 µM ZnCl2, 5% glycerol. Peak fractions were collected, pooled together, concentrated on a 100 kDa ultracentrifugal filter unit by centrifugation at 4000 rpm for 5 min and analyzed by SDS PAGE and Coomassie staining.
For large scale purification of His-tagged IN/LEDGF complex, cell pellets were suspended in buffer A (50 mM Hepes pH 7.5, 400 mM NaCl, 2 mM MgCl2, 2 mM β mercaptoethanol, 1 tablet of a protease inhibitor cocktail (Roche)) containing 10 mM imidazole at a ratio of 5ml buffer for 1 g cell pellet. Cell suspensions were sonicated 15 minutes with a 2 seconds on/off cycle. The lysed cells were then centrifuged at 100,000 g for one hour and the supernatants recovered and filtered through a 5 µm cellulose acetate filter. The soluble proteins were then run through a 5 ml HisTrap excel Ni Sepharose column equilibrated with buffer A containing 10 mM imidazole. A 3-step wash was then performed with 10 column volumes of the same buffer (A with 10 mM Imidazole), then buffer A with 20 mM imidazole and buffer A with 40 mM imidazole. Finally, elution of His-tagged proteins was carried out with an imidazole gradient from 40 mM to 500 mM. Peak fractions were collected and analyzed by SDS PAGE and Coomassie staining. Fractions of interest were then pooled together and concentrated to 5 ml on a 100 kDa ultracentrifugal filter unit by centrifugation at 4000 rpm for 10 min. Proteins were then purified by size exclusion on a Hi Load 16/60 superdex-200 column (GE Healthcare) pre-equilibrated in buffer A. Peak fractions were collected and analyzed by SDS PAGE and Coomassie staining.
Measurement of cytidine deaminase and integrase activities
The cytidine deaminase activity of APOBEC3G alone or in a multi-protein complex was determined following a previously described method with a few modifications[38]. Briefly, 40 µM of the 39 base pair oligonucleotide 5’ AAAGAGAAAGAGAAACCCAAAGAGGAAAGGTGAGGAGGA 3’, where the third C in the CCCA motif may be deaminated, was incubated in buffer A (20 mM Tris-HCl pH 7.5, 30 mM NaCl, 10 µM MgCl2 and 5 mM DTT) in the presence of infected cell lysates for two hours at 37°C. DNA was then extracted with phenol-chloroform, ethanol precipitated, solubilized in buffer A and treated with 10 units uracil glycosylase for two hours at 37°C to remove the uracils created by cytidine deaminase activity. Finally alkaline hydrolysis of the abasic oligonucleotide for 20 min at 95°C in 0.2 M NaOH cut the abasic 39 oligonucleotides into 17 and 21 long oligonucleotides which were separated on an anion exchange column (Nucleopac PA-100 form Dionex).
The IN 3’processing activity was monitored by fluorescence anisotropy as described previously[39]. The reaction was done in 96 well-plates. One well contained 100 µL of reaction mix composed of 25 mM BisTris pH 6.5, 10 mM MgCl2, 5 mM DTT, 50 nM DNA and 200 nM protein complex. The DNA substrate was a 40 base pair double strand DNA (5'-GACTACGGTTCAAGTCAGCGTGTGGAAAATCTCTAGCAGT-3’), mimicking the U5 end of HIV-1 DNA and 3’ modified by 6-fluorescein. After homogenization, 25µL of paraffin oil was added on the top of the well to avoid evaporation. Fluorescence anisotropy measurements were performed on a PHERAstarPlus (BMGLab) spectrophotofluorimeter with an excitation polarized wavelength of 470 nm. The reaction was monitored for 5 hours at 37°C.