Lithium Chloride Sensitivity Connects the Activity of PEX11 and RIM20 to PGM2 translation

doi:10.21203/rs.3.rs-1230852/v1

Download PDF

Research Article

Lithium Chloride Sensitivity Connects the Activity of PEX11 and RIM20 to PGM2 translation

https://doi.org/10.21203/rs.3.rs-1230852/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Lithium chloride (LiCl) is a widely used and extensively researched drug for the treatment of bipolar disorder (BD). As a result, LiCl has been the subject of research studying its toxicity, mode of action, and downstream cellular responses. LiCl has been shown to influence cell signalling and signalling transduction pathways through protein kinase C and glycogen synthase kinase-3 in mammalian cells. LiCl's significant downstream effects on the translational pathway necessitate further investigation. In yeast, LiCl is found to lower the activity and alter the expression of PGM2, a gene encoding a sugar-metabolism phosphoglucomutase. When phosphoglucomutase activity is reduced in the presence of galactose, intermediates of galactose metabolism aggregate, causing cell sensitivity to LiCl. In this study, we identified that deleting the genes PEX11 and RIM20 increases yeast LiCl sensitivity. We further show that PEX11 and RIM20 regulate the expression of PGM2 mRNA at the translation level. The observed alteration of translation seems to target the structured 5′-untranslated region (5′-UTR) of the PGM2 mRNA.

Molecular Biology

General Biochemistry

lithium chloride

cell sensitivity

molecular toxicity

gene expression

yeast

mRNA

translation

bipolar disorder

Bipolar disorder (BD) has been linked to signaling transduction dysregulation [1]. Over the past several decades, owing to demonstrated therapeutic potential, treatment with lithium chloride (LiCl) has proven to be a successful treatment for BD patients [2]. LiCl has since been used to combat other psychoses, and its potential effectiveness against neurodegenerative diseases [3, 4] is notable. Signal transduction mechanisms of glycogen synthase kinase-3 and protein kinase C, which are implicated in neuronal plasticity and progression, were shown to be influenced by LiCl [5, 6]. BD patients who received lithium therapy were reported to have altered expression of protein kinase C and phosphoinositide enzymes [7, 8]. Furthermore, LiCl exhibits anti-inflammatory, protein homeostasis, cytoprotective, and synaptic repair properties, culminating in LiCl as a potential multi-directed treatment, applicable in relieving a wide range of conditions, including Alzheimer's [2, 3]. Multiple downstream targets, such as brain-derived neurotrophic factor and β-catenin, have been shown to interact with lithium [9, 10]. Although LiCl has been a standard treatment for decades, further research is needed to reveal its possible effect on established and unknown gene pathways in the human body.

Previous research has established the budding yeast, Saccharomyces cerevisiae cell sensitivity to LiCl, primarily when galactose is used as the primary carbon source. LiCl sensitivity in yeast was observed to be induced by a difference in PGM2 expression and activity. PGM2, a phosphoglucomutase, facilitates the entry of galactose into the glycolysis pathway. PGM2 enzyme catalyzes the transfer of glucose-1-phosphate to glucose 6-phosphate, which, if impaired, triggers intermediate metabolite aggregation and toxicity in yeast cells [11]. Consequently, when yeast cells are grown on galactose media containing LiCl, cell growth is severely hampered due to metabolite aggregation and glycolysis impairment. Subsequently, uridine diphosphate glucose levels are significantly hindered in yeast cells during LiCl treatment, further inhibiting glucose-related pathways (Masuda et al., 2001). Prior research indicates that LiCl can inhibit enzymes involved in the processing of rRNA, ribosomal protein precursors, and the amount of mature mRNA in the cytoplasm, implying inhibition at the translational level.

Eukaryotic initiation factors (eIFs) are heavily involved in the regulation of translation initiation [13]. The initiation factor eIF4A (TIF2) is a prototypical DEAD-box RNA helicase that functions together with eIF4B, eIF4H and eIF4F to untangle and prepare the ribosome binding mRNA template by unwinding the secondary structure proximal to 5′ untranslated region (UTR). It is reported that eIF4A is involved in LiCl stress in yeast [14]. Overexpression of eIF4A is shown to recover sensitivity of the yeast cells to LiCl in galactose media. Similar observation has also been reported for other genes linked to the translation of structured mRNAs in yeast [15, 16]. Deletion mutants for these genes showed increased sensitivity to LiCl.

In the current study, we report that deletion of PEX11 and RIM20 increase cell sensitivity to LiCl when the gene mutant strains are grown in galactose. The primary reported function of PEX11 is to mediate fatty acid oxidation and induce peroxisome proliferation[17]. RIM20 is shown to be actively involved in pH response and multivesicular body formation[18, 19]. Our subsequent genetic studies indicate that these genes are involved in regulating the translation of PGM2 mRNA.

2.1 Strains and Plasmids

The MAT “α” mating strain, Y7092 can1∆::STE2pr-Sp_his5 lyp1∆ his3∆1 leu21∆0 ura3∆0 met15∆0 and MAT “a” mating strain, Y7092 Y4741 orf∆::KanMAX4 his3∆1 leu2∆0 met15∆0 ura3∆0are utilized in this study. To construct double deletion mutant strains, non-essential gene deletion mutant strains were collected from the Yeast knockout library [20] and used for Synthetic Genetic Analysis (SGA). SGA gene knockouts in MATα mating strains were accomplished using PCR and homologous recombination after the Lithium acetate process, as followed by previous PCR studies [21, 22]. The yeast overexpression plasmid library was used to generate overexpression plasmids for the gene candidates [23]. Thermofisher® Yeast gene-GFP fusion library is purchased and used to generate PGM2-GFP fusion strain for qRT-PCR and western blot analysis as shown before [24–26]. Chemical sensitivity and PCR analyses are used to validate the overexpression plasmid. A modified SGA approach coupled with random spore analysis is used to establish deleted genes reinserted into their respective deletion mutant strains [27, 28]. Crossing MATα with nourseothricin sulphate (clonNAT) and MATa with a G418 resistance gene in lieu of the gene deletion of interest results in modified SGA. For MATa haploid progeny selection, spores germinated on selective media containing thialysine and canavanine after sporulation. G418 sensitivity was examined using replication plating after the cells were transferred to clonNAT media. PCR analysis was conducted to validate the target gene inside the chromosome in colonies immune to clonNAT but sensitive to G418. The p416 plasmid carried a non-complex construct, used as the control plasmid and carried a LacZ expression cassette under gal promoter control. HIV1 (TAR), RTN4IP1 (RTN), BCL-2 (Bcell) and 2-hair hairpin constructs were designed and cloned into the p416 expression vector upstream of LacZ mRNA using XbaI restriction site between the β-galactosidase reporter gene (LacZ expression cassette) and gal promoter.

Expression constructs for pTAR construct contains the 5’ UTR of HIV1-TAR gene (5’ GGTTCTCTGGTTAGCCAGATCTGAGCCCGGGAGCTCTCTGGCTAGCTAGGGAACCCACTGCTTAAGCCTCAATAAAGCTTGCCTTGAGTGCTTCAAGTAGTGTGTGCC 3’) and pRTN contains 5’ UTR of FOAP-11 gene(5’GGGATTTTTACATCGTCTTGGTAAAGGCGTGTGACCCATAGGTTTTTTAGATCAAACACGTCTTTACAAAGGTGATCTAAGTATCTC3’), pBCell contains 5'UTR of BCL-2 gene (5′ GGGGGCCGUGGGGUGGGAGCUGGGGGGGCCGUGGGGU GGGAGCUGGG 3′) and 2-hair has 5’ UTR of construct (5' CTTGGTAAAGGGGGUGGTCTGAGCCCGGGAGCTCTCTGCTGCTTAAGCCTCGGATTTT 3’). Plasmids included an ampicillin resistance gene for selection in DH5α (in E.Coli) and a URA3 gene selection in yeast.

2.2 Media Inoculation

Yeast cultures were grown with either YP media (1% Yeast extract and 2% Peptone) or Synthetic Complete media with selective amino acids (0.67% Yeast nitrogen base w/o amino acids and 0.2% amino acid dropout mixture). The carbon source in yeast media was either 2% glucose or 2% galactose. Agar at 2% was used to make solid media. LB media (Lysogeny Broth) was used for E.Coli cultures. GeneJET plasmid miniprep kit (Thermofisher®, Ottawa, ON, Canada and Bio-Basics®, Toronto, ON, Canada) was used for E. coli plasmid extraction, and yeast plasmid miniprep kit (Omega Biotek®, Norcross, GA, USA) was used for yeast plasmid extraction; all kits were used as directed by the manufacturer.

2.3 LiCl sensitivity analysis

Specific colonies of yeast are cultivated for two days at 30^oC in liquid YPgal (YP + 2% galactose) media before growth saturation. Liquid cultures are standardized to an OD 0.1 at 600nm after incubation, serially diluted (10⁻¹ to 10⁻⁴) and spot platted (10ul per spot) onto agar YPgal media with 10 mM LiCl treatment. Sensitivity to LiCl could be assessed by comparing gene deletion strains with wild type (WT). Overexpression constructs pPEX11 and pRIM20 are transformed into our gene deletion strains to validate observed sensitivities due to the deletion of our candidate genes. For quantification analysis, colony counting was performed using 100 µL of diluted 10⁻⁴ concentration cell cultures then spread onto YPgal plates with and without 10 mM LiCl. The colonies were counted after a 48h incubation at 30°C. Each experiment was conducted in triplicates. One way ANOVA analysis (P-value ≤ 0.05) was used to determine significant statistical differences.

2.4 mRNA quantification analysis

PGM2-GFP yeast strain grown in liquid YPgal media with 10 mM LiCl treatment was used to determine PGM2 mRNA concentrations in different deletion strains. Max RNA is collected using the Qiagen® RNeasy Mini Pack. iScript The Bio-Rad® cDNA Synthesis Kit (Mississauga, ON, Canada) was used to create complementary DNA and Bio-Rad® iQ SYBR Green Supermix along with CFX connect real-time system (Bio-Rad®) are used to perform qRT-PCR. The housekeeping gene PGK1 is used as an internal control. Experimentation and data processing is carried out in compliance with MIQE guidelines [29]. Experiments are replicated with three technical and biological replicates. One way ANOVA analysis (P-value ≤ 0.05) was used to determine significant statistical differences. Primers PGK1 Forward: ATGTCTTTATCTTCAAAGTT; Reverse: TTATTTCTTTTCGGATAAGA; PGM2 Forward: GGTGACT CCGTCGCAATTAT; R: CGTCGAACAAAGCACAGAAA

2.5 PGM2 Protein content measurement

Quantitative western blotting is used to determine the protein content of the PGM2p-GFP fusion protein. Mutant strains were cultured in liquid YPgal media with 10 mM LiCl. The protein extraction process is carried out as mentioned previously [30]. Bradford Protein Assay (BSA) was used to determine the protein concentration. 50ug of total extracted protein were loaded onto a 10% SDS-PAGE gel and ran through the Mini-PROTEAN Tetra cell electrophoresis apparatus method (Bio-Rad®). Trans-Blot Semi-Dry Transfer (Bio-Rad®) was used to transfer protein through a 0.45 µm nitrocellulose membrane. PGM2p-GFP protein levels are detected using a mouse monoclonal anti-GFP antibody (Santa Cruz®), and PGK1 protein levels are measured using a mouse monoclonal anti-PGK1 antibody (internal control). Immunoblot visualization and densitometry research are carried out using chemiluminescent substrates (Bio-Rad®), the Vilber Lourmat gel doc Fusion FX5-XT (Vilber®), and the FUSION FX app (Vilber®). Experiments are replicated with three technical and biological replicates. One way ANOVA analysis (P-value ≤ 0.05) was used to determine significant statistical differences.

2.6 Quantitative β-galactosidase Assay

Translation initiation activity of our gene deletion strains is investigated using, LacZ reporter constructs (as previously described). LacZ activity was assessed using the assay as a quantitative tool to quantify translational activity in mutant yeast strains. The assay was carried out using O-nitrophenyl—d-galactopyranoside [31, 32]. Experiments are repeated three times with technological and biological replicates. Meaningful variations are evaluated using a one-way ANOVA study (P-value 0.05).

2.7 Genetic Interaction Analysis

Genetic interactions analysis for our candidate genes (GI) were investigated using a 384 formatted SGA. The yeast double deletion mutant library is generated as previously shown [24, 25, 28]. A query strain (MATα, Y7092) carrying a gene deletion of interest and a clonNAT marker is mated with our three non-essential gene deletion sets, comprising ~1000 MATa mutants. Following rounds of selection, haploid double gene deletion mutants are selected. Successful gene knockout transformations were identified using PCR analysis with pAG25 plasmid as the template. The clonNAT resistance gene marker was amplified, with NAT and Kanamycin used as selection markers. Conditional SGA is carried out by growing the generated double mutants in a chemical stress condition [33] on sub-inhibitory, 3 mM LiCl agar media. This facilitates the investigation of genes that only express under LiCl stress conditions [25, 34]. Phenotypic Suppression Array (PSA) is performed by mating an empty plasmid, MATa single deletion library, and an overexpression plasmid of a query gene carried by MATα yeast strain, as mentioned previously for the SGA mating protocol. Strains with and without the overexpression plasmid are compared and grown in media with LiCl treatment. Overexpression of query genes was used to examine whether there is some phenotypic shift with inhibitory LiCl treatment. A proposed functional relation between these two genes could then be established [22, 33].

2.8 Genetic Interaction data Analysis

The size of the colony determines cell fitness [28, 35]. Colony size comparisons between the control (WT) and single deletion mutants are performed to determine if any phenotypic changes (synthetic illness or synthetic lethality) exist. Normalized colony sizes were then compared. The fitness threshold for yeast cells is set to a minimum of 30% size reduction in contrast to the control. SGA Software was used to measure colony sizes and similarities [36]. Only size reductions of 50–95% are taken into consideration. This experiment was repeated three times, each time with a separate technical replication. Only hits of at least two replicates are taken into consideration. Finally, identified hits are then classified according to their biological processes and molecular function and then enriched with Gene ontology terminology using tools including the Genemania database. http://genemania.org (accessed on January 18, 2021) and complex functionality profiling http://webclu.bio.wzw.tum.de/profcom/start.php (Referenced on January 23, 2021).

3.1 Yeast tolerance to Lithium Chloride is eroded by gene deletions of PEX11 and RIM20

Chemical-genetic approaches have the ability to allow the detailed annotation of the functional properties of various chemicals and bioactive compounds. They can shed light on a compound's primary mode of action as well as its secondary sites of interactions within a cell [24]. The sensitivity of mutant strains to a target compound is a powerful approach for determining the target pathways and the impact a compound has on a cell at the molecular level. In the current study, while investigating yeast gene deletion mutants that are sensitive to LiCl, we discovered two deletion mutants for PEX11 and RIM20, that exhibited increased sensitivity to LiCl (Figure 1A, B) compared to a control strain (Figure 1A). Using a spot test analysis, we demonstrate that when cells are grown in media containing galactose as the primary carbon source, deletion of PEX11 and RIM20 resulted in a substantial reduction in growth in the presence of 10 mM LiCl, indicating increased sensitivity. Deletion of TIF2 (eIF4A) was used as a positive control. Further we demonstrated that incorporating the deleted genes back into the corresponding gene deletion mutants reversed the observed growth reduction establishing a correlation between the observed phenotypes and the deleted gene. Colony count measurement analysis further validated these results by offering a quantitative viewpoint (Figure 1B). The formation of colonies observed in the presence of LiCl is compared and normalized to the number of colonies observed in the control strain. Lower number of colonies formed for gene deletion mutants indicates increased sensitivity to LiCl compared to the control strain. As shown in Figure 1B, deletion of TIF2, PEX11 and RIM20 under the influence of LiCl results in a significant reduction in colony formation. As before reintroduction of the deleted genes back into the corresponding mutant cells increased the number of colonies formed to levels comparable to that of the control strain. Additionally, we examined yeast strains' exposure to LiCl when glucose was used as the carbon source. As expected, no increased sensitivity for the mutant strains was observed when glucose was used (S1. Figure).

Previously, it was stated that overexpression of TIF2 reversed the toxicity of susceptible strains to LiCl. We inserted overexpression plasmids for our candidate genes into corresponding deletion strains spotted on media containing 10 mM LiCl to see whether they would similarly restore LiCl sensitivity. When the plasmids were integrated into the mutant strains, fitness was restored, suggesting that they may function similarly to eIF4A in the cell.

When galactose is used as the carbon source, LiCl inhibits PGM2 expression, resulting in the accumulation of galactose intermediate metabolites that are toxic to yeast cells [11]. GAL1 is the galactokinase in yeast that phosphorylates -D-galactose to -D-galactose-1-phosphate in the initial stages of galactose metabolism. By converting glucose-1-phosphate to glucose-6-phosphate, PGM2 promotes galactose entry into glycolysis. We investigated the impact of PEX11 and RIM20 on LiCl toxicity when galactose metabolism was disabled. For this purpose, we developed double gene deletions for PEX11 and RIM20 with the GAL1 gene. Not surprisingly, we observed GAL1 double mutant cells were no longer hypersensitive to LiCl treatment. PEX11 and RIM20 have not been previously linked to LiCl sensitivity or the underlying molecular mechanisms associated with it, rendering them intriguing gene candidates to investigate.

3.2 PGM2 Expression is Controlled at the Translational Level by PEX11 and RIM20.

PGM2 plays a key role in the sensitivity of yeast cells to LiCl[12], we investigated whether PEX11 and RIM20 will influence PGM2 expression. For this PGM2p was GFP-tagged, and western blot analysis was performed using anti-GFP antibodies to quantify protein content (Figure 2A). The deletion of PEX11 and RIM20 had no substantial effect on PGM2p protein levels in the absence of LiCl treatment. Interestingly, when cells were treated with LiCl, PEX11 and RIM20 gene deletion resulted in a significant reduction of PGM2p protein levels compared to the WT. To analyze the effect of PEX11 and RIM20 gene deletion on PGM2 transcription, the mRNA content of PGM2 was measured using qRT-PCR. Figure 2B indicates that deletion of PEX11 and RIM20 had similar levels of PGM2 mRNA levels as the WT in control media. However, PGM2 mRNA content increased in cells treated with LiCl, but there was no statistically relevant difference between mutant strains and WT. Thus, the deletion of PEX11 and RIM20 seems to have little influence on PGM2 mRNA content. As a result, it appears that PEX11 and RIM20 influence PGM2p at the level of protein synthesis. These findings are similar to the observations by Hajikarimlou et al., where in the presence of LiCl, deletion of YTA6 and YPR096C inhibited PGM2 expression at the translational level [16].

3.3 Deletion of PEX11 and RIM20 Influences Translation of β-Galactosidase Reporter mRNAs with a Hairpin Structure, but not Those Without

Several genes that affected PGM2 expression at the translation level, used the 5’-UTR of PGM2 mRNA to exert their activities. The 5’-UTR of PGM2 mRNA is predicted to have a structured region (S2. Figure) and in the absence of TIF2, a protein that unwinds mRNA structures during translation, PGM2 expression is reduced [14]. Next we intended to investigate whether PEX11 and RIM20 affect translation using the structured 5’-UTR of PGM2 mRNA. For this experiment, we utilized pPGM2 plasmid where the PGM2 5’-UTR is placed in front of a LacZ expression cassette in the p416 expression plasmid. The pPGM2 plasmid, as well as the parental p416 plasmid lacking a structural region in front of the LacZ gene were transformed into the deletion mutant strains for our candidate genes as well as the WT strain. β -galactosidase activity was quantified as a measure of translation (Figure 3A). No significant difference was observed for β -galactosidase activity derived from mRNAs lacking a 5’-UTR structure (p416) in different strains. β -galactosidase activity was significantly reduced however in pex11∆ and rim20∆ when the mRNA carried PGM2 5’-UTR suggesting a connection between the activity of PEX11 and RIM20, and the translation of structured mRNAs.

Next, we examined the effect of PEX11 and RIM20 on additional structured mRNAs. For this we utilized four additional constructs each carrying different structures at their 5’-UTR. pTAR carries a structure derived from HIV1 mRNA containing a ΔG= -57.9kcal/mol and pRTN carries the structured 5’-UTR of RTN4IP1 mRNA with ΔG= -29.8kcal/mol. Similarly, pBcell carries a structure derived from BCL-2 mRNA and a ΔG= -20kcal/mol. The last construct, p2hair contains a synthetic structure designed to have a high degree of complexity ΔG= -33kcal/mol. In our analysis. we observed that deletion of PEX11 and RIM20 significantly reduced the expression of all four highly structured mRNAs, comparing the WT suggesting a general role for these two genes in the translation of structured mRNAs (Figure 4).

3.4 Genetic Interaction Analysis Further Connects the Activity of PEX11 and RIM20 to Protein Biosynthesis

Genetic interaction (GI) analysis is based on the principle that parallel pathways allow for flexibility and tolerance to random harmful mutations, preserving cells viability and maintaining cell homeostasis [16]. A gene in one pathway might compensate for a gene in another, allowing the cell to survive. Consequently, when two genes in parallel pathways are deleted, cell fitness can be unexpectedly reduced (sickness) or even the cell dies (lethality). Therefore, when deletion of two genes result in a phenotype that is unexpected from the phenotypes of individual gene deletions, it is commonly said that the two genes are forming a genetic interaction. Due to the reduced fitness of double mutant this type of interaction is called negative genetic interaction (nGI). Many studies use nGIs to investigate gene function and pathway interactions [15, 16, 29, 37].

The high throughput analysis of GIs in yeast is performed by mating the two yeast mating types: α-mating type (Mat α) and a-mating type (Mat a). Mat "α" carries the target gene deletion and is crossed with an array of single gene deletions of Mat "a," mating type, to produce double gene deletions[28]. Colony size is used to measure the fitness of the strains[35, 38]. We utilised this method to investigate genetic connections between our query genes, PEX11 and RIM20, with approximately 1000 additional genes that includes approximately 700 genes associated with gene expression pathway and a random collection of 300 genes used as a control. (S1. Table).

In our analysis, we discovered numerous intriguing nGIs and several common gene hits between PEX11 and RIM20. Functional enrichment analysis of the hits revealed that a significant number of them are connected to relevant biological processes that includes translation regulation, ribosome biology,, mRNA catabolic processes, and protein synthesis and protein synthesis associated factors (Figure 5). For PEX11, we identified nGIs including DPH5, PCI8, EAP1, and TIF1 among others. The methyltransferase, DPH5 is engaged in the diphthamide biosynthesis pathway, responsible for assembly of translation elongation factor 2 (Eft1p or Eft2p[39]., PCI8 forms the subunit of translation initiation factor, eIF3b, contributing to the formation of 43S pre-initiation complex during translation initiation. It is a key factor in cellular signalling at all stages of protein synthesis, including elongation, termination, and ribosome recycling[40]. EAP1, is also involved in translation initiation process. It is an associated protein of translation initiation factor eIF4E, which forms a part of eIF4F complex. It could potentially enhance/inhibit the overall translation rate by facilitating mRNA degradation and promoting mRNA decapping[41].

Similarly, RIM20 interacted with several translation machinery associated genes including RPS23A, TOR1, and TMA19 (Figure 5). RPS23A codes for the ribosomal protein 28 (rp28) and forms a component of the 40S small ribosomal subunit[42]. Translation regulator protein TOR1 is a member of the TOR complex, which is known to regulate global translation rate through signal transduction. Under stress environments, the TOR-related proteins TOR1 and TOR2 control translation initiation and promote early G1 progression in yeast[43]. TMA19 codes for Translation Machinery Associated protein 19 that interacts with ribosomes during translation initiation. [44].

We also observed several common interactors between PEX11 and RIM20 including SLH1, and CAF20. SLH1 is a putative RNA helicase that is directly implicated in the translation inhibition of non-poly(A) mRNAs. [45]. CAF20 is a translational control phosphoprotein found in the mRNA cap-binding complex. It acts as a regulator of cap-dependent translational initiation [46].

Conditional nGIs are those interactions that are formed under a specific condition that includes the presence of a sub-inhibitory concentration of a bioactive compound, cold shock, heat shock, minimum media etc. They represent gene functional associations that are formed in response to a certain environment[30, 47]. For example, in the presence of DNA damage, the functions of certain genes may be altered, and it is the altered functions that are functionally related and hence form the basis of GIs in the presence of DNA damage[48]. We investigated nGIs for PEX11 and RIM20 using a mild sub-inhibitory concentration of LiCl (3 mM). The observed GIs in this case are those that are formed as a response to the presence of LiCl. As seen in Figure 6, we found new nGIs for our candidate genes PEX11 and RIM20. PEX11 interacted with several translation regulating genes including PBP1, and EBS1 among others. PBP1 is a component of glucose-deprived induced stress granulates that influences global translation rate through the TORC1 signalling pathway and autophagy. It is also known to have an active role in controlling mRNA polyadenylation by interacting with Pab1P, which influences initiation of translation during protein biosynthesis[49]. EBS1 codes for a protein involved in translation inhibition by interacting with cap binding proteins CDC33 and NAM7 upon glucose starvation. It also regulates translation initiation factor eIF4E, another cap binding protein that binds to 5’ end of the mRNA during the formation of 48S initiation complex in translation initiation step[50]. Interestingly, eIF4E is a component of the eIF4F complex, that comprises of eIF4A, eIF4G and eIF4E[51]. eIF4G is a scaffolding protein and eIF4A is a DEAD-box helicase protein that is actively involved in unwinding structured mRNAs during translation initiation. PEX11 interacting with EBS1 may indirectly influence helicase activity of eIF4A and potentially affect other helicases influencing global translation rate.

Similarly, RIM20 interacted with several news genes involved in translation control and regulation of translation. ETT1 is a nuclear protein that regulates overall translation rate and enhances/inhibits protein synthesis by influencing initiation and termination step during translation[52]. Under extreme stress conditions, PTP2 modulates phosphorylation in the MAPK signalling pathway, affecting mRNA decapping and mRNA stability influencing overall translation rate[53]. RPS19B is a protein component of the 40s ribosomal subunit that participates in the assembly of 43s pre-initiation complex by binding matured mRNA to small ribosomal subunit with translation initiation factors eIF1A and eIF3 during protein synthesis[54].

Notably, we also observed several common interactors between PEX11 and RIM20 including DHH1, TIF2, and SHE3 that are involved in translation control. DHH1 is a cytoplasmic DEAD-box helicase that regulates translation process influencing mRNA stability, mRNA degradation and polyadenylation at 5’ end of mRNA[55]. As explained above, translation initiation factor, TIF2 is another DEAD box RNA helicase that facilitates the binding and unwinding of mRNA during translation initiation[51]. SHE3 is a RNA binding protein that constitutes a part of the mRNA localization machinery and plays an active role in recruiting Myo4p-She3 complex that is involved in mRNA export / localization into the cytoplasm, influencing global translation rate[56].

Phenotypic suppression array (PSA) analysis focuses on another kind of interaction in which overexpression of one gene compensates for the absence of another [24, 33, 57, 58]. This is an important type of interaction as it can highlight certain functional overlaps between two genes. To this end we exposed the gene expression mutant arrays to 10 mM LiCl. Some of the investigated strains showed increased sensitivity. Then, by introducing PEX11 and RIM20 overexpression plasmids, we attempted to compensate for the observed sensitive phenotypes. Interestingly, the overexpression of either PEX11 or RIM20 compensated for the sensitivity of two gene deletions for RPS30A and SLF1 (Figure 6A). RPS30A encodes a cytosolic small ribosomal subunit protein that can also bind to mRNAs and contributes to the selection of the correct tRNA molecules[59]. SLF1 is an RNA binding protein that regulates mRNA translation, especially under stress conditions. [60].

The recovery of the sick phenotype in gene deletions for SLF1, RPS30A by introducing RIM20 and PEX11 overexpression plasmid was confirmed using spot test (Figure 6B). This was further verified by cell quantification analysis using colony count (Figure 6C). Using spot test and colony count analysis we verified that the overexpression of RIM20 and PEX11 compensated the sensitivity to LiCl that was seen for deletion strain for RPS30A and SLF1. Both SLF1 and RPS30A have reported genetic interactions with TIF2. Consequently, we also included the deletion strain for TIF2 in the spot test for analysing LiCl sensitivity compensation. Interestingly, when PEX11 and RIM20 are overexpressed in TIF2 deletion, LiCl sensitivity caused by TIF2 deletion was also recovered further connecting the activity of these genes.

When used as a therapeutic molecule, LiCl has a broad impact on the expression of various genes and pathways among other activities. Its precise mechanism of action however remains unclear. Here, we examined yeast gene deletion mutant strains for LiCl sensitivity and discovered that when two genes, PEX11 and RIM20, were deleted, the corresponding deletion mutant strains were more sensitive to LiCl. TIF2 overexpression, which codes for eIF4A, the helicase enzyme involved in translation initiation, has been shown to restore LiCl sensitivity in yeast cells cultured on galactose media[14]. We determined that overexpression of our candidate genes causes a phenotypic recovery similar to TIF2, suggesting that these genes may have a similar/related function. In the literature the molecular activities for PEX11 and RIM20 have not been linked to LiCl sensitivity making these genes intriguing target for further study. LiCl toxicity in yeast is thought to be caused by the accumulation of galactose intermediate metabolites, particularly galactose-1-p[14, 15]. It has been shown that LiCl inhibits the conversion of glucose-1-phosphate to glucose-6-phosphate via modifying the expression of the phosphoglucomutase enzyme PGM2[11]. The current study shows that PEX11 and RIM20 influence PGM2 expression. We demonstrate that PEX11 and RIM20 regulate the translation of PGM2 mRNA via its 5′-UTR region. Similar observations were made using other mRNAs with various 5’-UTRs that carry different structures, but not for the ones without. We recently reported on the finding of several additional genes involved in the translation of structured mRNAs, [15, 16]. The identification of new gene functions that influences the translation of structured mRNAs suggests that translation of mRNAs with structures seems to be more complex than what was originally thought. Furthermore, it shows that the structured mRNAs might be subjected to a more complicated regulatory network during translation than previously hypothesized.

The impact of PEX11 and RIM20 on structured mRNA translation may be explained in a variety of ways. The simplest explanation is that one or more of these components may have mRNA helicase activity, which may directly contribute to the unwinding of the structured mRNAs at 5’UTR. In the absence of recognizable helicase motifs, the possibility of a helicase activity for these proteins is unlikely. It is also possible that these factors might affect the activity of other helicases and consequently, mediate the translation of structured mRNAs. Modifying the activity of ribosome can be another way that that PEX11 and RIM20 might influence the translation of structured mRNAs. There are no reported physical interactions between these factors and ribosomes making this a less likely scenario. However, in the current study we uncovered several interactions for RIM20 with several ribosomal proteins suggesting a potential link between RIM20 and ribosomes. An alternative explanation is that these factors may exert their activity on the biology of the mRNAs. In this way PEX11 and RIM20 might affect mRNA biogenesis or affect factors that contribute to mRNA biogenesis.

The findings of the current study further connect the biological activity of LiCl to the translation of structured mRNA in yeast. This knowledge may contribute to our understanding of the biology of BD. LiCl is widely considered to be a neuroprotective drug that prevents neuronal cell death. According to the observations made in the current study, LiCl's mode of action may include altering translation of certain structured mRNAs linked to the process of cell death and apoptosis. In future, it would be interesting to study the effect of LiCl on the translation of such mRNAs. Inhibiting the expression of these mRNAs may be considered for therapeutic purposes.

Acknowledgements

NSERC Discovery Grant.

Author Contributions

Professor Golshani is responsible for conceptual development of this study, co-executor of all experiments, and coordinators of the grants that supported this work. S. Jagadeesan, a PhD candidate, contributed to translation experiments as well as data analysis. M. Algafari, a PhD candidate, contributed to the experimental approaches and data analysis. M. Hajikarimlou, contributed to the experimental analysis. All authors contributed to the writing of the manuscript.

Data Availability

All data generated and/or analyzed during this study are included in this research article and/or its Supplementary Material Files).

Competing Interests

The authors declare no competing interests.

Compliance with Ethical Standards:

The authors declare that they have no known conflicting interests / financial interests or personal relationships that could have appeared to influence the work reported in this paper

The authors declare that there are no research activities involved with human participants or animals during this study

The authors declare that the research was carried out with full awareness and informed consents from all researcher groups involved in the study, meeting standard ethical guidelines.

Yan P, Xu D, Ji Y, Yin F, Cui J, Su R et al LiCl Pretreatment Ameliorates Adolescent Methamphetamine Exposure-Induced Long-Term Alterations in Behavior and Hippocampal Ultrastructure in Adulthood in Mice. The international journal of neuropsychopharmacology [Internet]. 2019 Apr 1;22(4):303–16. Available from: https://pubmed.ncbi.nlm.nih.gov/30649326
Machado-Vieira R, Manji HK, Zarate CA Jr (2009) The role of lithium in the treatment of bipolar disorder: convergent evidence for neurotrophic effects as a unifying hypothesis. Bipolar disorders [Internet]. Jun;11 Suppl 2(Suppl 2):92–109. Available from: https://pubmed.ncbi.nlm.nih.gov/19538689
Rowe MK, Chuang D-M (2004/10/18) Lithium neuroprotection: molecular mechanisms and clinical implications. Expert Reviews in Molecular Medicine [Internet]. 2004;6(21):1–18. Available from: https://www.cambridge.org/core/article/lithium-neuroprotection-molecular-mechanisms-and-clinical-implications/E91683A5862B5DAF6CDC8FD0B0F87024
Fornai F, Longone P, Cafaro L, Kastsiuchenka O, Ferrucci M, Manca ML et al Lithium delays progression of amyotrophic lateral sclerosis. Proceedings of the National Academy of Sciences [Internet]. 2008 Feb 12;105(6):2052. Available from: http://www.pnas.org/content/105/6/2052.abstract
Stambolic V, Ruel L, Woodgett JR (1996) Lithium inhibits glycogen synthase kinase-3 activity and mimics Wingless signalling in intact cells. Current Biology [Internet]. ;6(12):1664–9. Available from: https://www.sciencedirect.com/science/article/pii/S0960982202707902
Wang H-Y, Johnson GP, Friedman E (2001) Lithium treatment inhibits protein kinase C translocation in rat brain cortex. Psychopharmacology [Internet]. ;158(1):80–6. Available from: https://doi.org/10.1007/s002130100834
Castillo-Quan JI, Li L, Kinghorn KJ, Ivanov DK, Tain LS, Slack C et al (2016) Lithium Promotes Longevity through GSK3/NRF2-Dependent Hormesis. Cell reports [Internet]. 2016/04/07. Apr 19;15(3):638–50. Available from: https://pubmed.ncbi.nlm.nih.gov/27068460
Lenox RH, Wang L (2003) Molecular basis of lithium action: integration of lithium-responsive signaling and gene expression networks. Molecular Psychiatry [Internet]. ;8(2):135–44. Available from: https://doi.org/10.1038/sj.mp.4001306
Bathina S, Das UN (2015/12/11) Brain-derived neurotrophic factor and its clinical implications. Archives of medical science: AMS [Internet]. 2015 Dec 10;11(6):1164–78. Available from: https://pubmed.ncbi.nlm.nih.gov/26788077
Yang Y, Yang J, Liu R, Li H, Luo X, Yang G (2011) Accumulation of β-catenin by lithium chloride in porcine myoblast cultures accelerates cell differentiation. Molecular Biology Reports [Internet]. ;38(3):2043–9. Available from: https://doi.org/10.1007/s11033-010-0328-3
Jing-Jing L, Guo-Chang Z, Iok KI, Ju YE, Jia-Qi Z, Dae-Hyuk K et al A Mutation in PGM2 Causing Inefficient Galactose Metabolism in the Probiotic Yeast Saccharomyces boulardii. Applied and Environmental Microbiology [Internet]. 2021 Oct 15;84(10):e02858-17. Available from: https://doi.org/10.1128/AEM.02858-17
Masuda CA, Xavier MA, Mattos KA, Galina A, Montero-Lomelí M (2001) Phosphoglucomutase Is an in Vivo Lithium Target in Yeast *. Journal of Biological Chemistry [Internet]. Oct 12;276(41):37794–801. Available from: https://doi.org/10.1074/jbc.M101451200
Jackson RJ, Hellen CUT, Pestova T (2010 Feb;11(2):113–27) v. The mechanism of eukaryotic translation initiation and principles of its regulation. Nature reviews Molecular cell biology [Internet]. Available from: https://pubmed.ncbi.nlm.nih.gov/20094052
Montero-Lomelí M, Morais BLB, Figueiredo DL, Neto DCS, Martins JRP, Masuda CA The Initiation Factor eIF4A Is Involved in the Response to Lithium Stress in Saccharomyces cerevisiae*. Journal of Biological Chemistry [Internet]. 2002 Jun 14;277(24):21542–8. Available from: https://doi.org/10.1074/jbc.M201977200
Hajikarimlou M, Hunt K, Kirby G, Takallou S, Jagadeesan SK, Omidi K et al Lithium Chloride Sensitivity in Yeast and Regulation of Translation. International journal of molecular sciences [Internet]. 2020 Aug 10;21(16):5730. Available from: https://pubmed.ncbi.nlm.nih.gov/32785068
Hajikarimlou M, Moteshareie H, Omidi K, Hooshyar M, Shaikho S, Kazmirchuk T et al Sensitivity of yeast to lithium chloride connects the activity of YTA6 and YPR096C to translation of structured mRNAs. PLOS ONE [Internet]. 2020 Jul 8;15(7):e0235033-. Available from: https://doi.org/10.1371/journal.pone.0235033
van Roermund CW, Tabak HF, van den Berg M, Wanders RJ, Hettema EH Pex11p plays a primary role in medium-chain fatty acid oxidation, a process that affects peroxisome number and size in Saccharomyces cerevisiae. The Journal of cell biology [Internet]. 2000 Aug 7;150(3):489–98. Available from: https://pubmed.ncbi.nlm.nih.gov/10931862
Xu W, Smith FJ Jr, Subaran R, Mitchell AP (2004 Dec;15(12):5528–37) Multivesicular body-ESCRT components function in pH response regulation in Saccharomyces cerevisiae and Candida albicans. Molecular biology of the cell [Internet]. 2004/09/15. Available from: https://pubmed.ncbi.nlm.nih.gov/15371534
Xu W, Mitchell AP Yeast PalA/AIP1/Alix homolog Rim20p associates with a PEST-like region and is required for its proteolytic cleavage. Journal of bacteriology [Internet]. 2001 Dec;183(23):6917–23. Available from: https://pubmed.ncbi.nlm.nih.gov/11698381
Winzeler EA, Shoemaker DD, Astromoff A, Liang H, Anderson K, Andre B et al (1999) Functional Characterization of the S. cerevisiae Genome by Gene Deletion and Parallel Analysis. Science [Internet]. ;285:901. Available from: https://link.gale.com/apps/doc/A55578476/AONE?u=ocul_carleton&sid=bookmark-AONE&xid=ddd568ee
Karlsson-Rosenthal C, Millar JBA (2006) Cdc25: mechanisms of checkpoint inhibition and recovery. Trends in Cell Biology [Internet]. Jun 1;16(6):285–92. Available from: https://doi.org/10.1016/j.tcb.2006.04.002
Samanfar B, Omidi K, Hooshyar M, Laliberte B, Alamgir MD, Seal AJ et al (2013) Large-scale investigation of oxygen response mutants in Saccharomyces cerevisiae. Molecular BioSystems [Internet]. ;9(6):1351–9. Available from: http://dx.doi.org/10.1039/C3MB25516F
Sopko R, Huang D, Preston N, Chua G, Papp B, Kafadar K et al (2006) Mapping Pathways and Phenotypes by Systematic Gene Overexpression. Molecular Cell [Internet]. Feb 3;21(3):319–30. Available from: https://doi.org/10.1016/j.molcel.2005.12.011
http://biorxiv.org/content/early/2018/05/25/331009.abstract
Alamgir M, Erukova V, Jessulat M, Azizi A, Golshani A (2010) Chemical-genetic profile analysis of five inhibitory compounds in yeast. BMC Chemical Biology [Internet]. ;10(1):6. Available from: https://doi.org/10.1186/1472-6769-10-6
Jessulat M, Malty RH, Nguyen-Tran D-H, Deineko V, Aoki H, Vlasblom J et al (2015 Jul;35(14):2448–63) Spindle Checkpoint Factors Bub1 and Bub2 Promote DNA Double-Strand Break Repair by Nonhomologous End Joining. Molecular and cellular biology [Internet]. 2015/05/11. Available from: https://pubmed.ncbi.nlm.nih.gov/25963654
Yan TAH, Guillaume L, Huiming DBG, Hong D, Xiaofeng X X, et al (2004) Global Mapping of the Yeast Genetic Interaction Network. Science [Internet]. Feb 6;303(5659):808–13. Available from: https://doi.org/10.1126/science.1091317
Yan TAH, Marie E, Hong BPA, Nicholas XDBG P, et al (2001) Systematic Genetic Analysis with Ordered Arrays of Yeast Deletion Mutants. Science [Internet]. Dec 14;294(5550):2364–8. Available from: https://doi.org/10.1126/science.1065810
Bustin SA, Benes V, Garson JA, Hellemans J, Huggett J, Kubista M et al (2009) The MIQE Guidelines: Minimum Information for Publication of Quantitative Real-Time PCR Experiments. Clinical Chemistry [Internet]. Apr 1;55(4):611–22. Available from: https://doi.org/10.1373/clinchem.2008.112797
AU, - Szymanski EP, - Kerscher AU (2013) O. Budding Yeast Protein Extraction and Purification for the Study of Function, Interactions, and Post-translational Modifications. JoVE [Internet]. ;(80):e50921. Available from: https://www.jove.com/t/50921
Stansfield I, Akhmaloka, Tuite MF (1995) A mutant allele of the SUP45 (SAL4) gene of Saccharomyces cerevisiae shows temperature-dependent allosuppressor and omnipotent suppressor phenotypes. Current Genetics [Internet]. ;27(5):417–26. Available from: https://doi.org/10.1007/BF00311210
Krogan NJ, Kim M, Tong A, Golshani A, Cagney G, Canadien V et al (2003 Jun;23(12):4207–18) Methylation of histone H3 by Set2 in Saccharomyces cerevisiae is linked to transcriptional elongation by RNA polymerase II. Molecular and cellular biology [Internet]. Available from: https://pubmed.ncbi.nlm.nih.gov/12773564
Samanfar B, Shostak K, Moteshareie H, Hajikarimlou M, Shaikho S, Omidi K et al (2017) The sensitivity of the yeast, Saccharomyces cerevisiae, to acetic acid is influenced by DOM34 and RPL36A. Fahrenkrog B, editor. PeerJ [Internet]. ;5:e4037. Available from: https://doi.org/10.7717/peerj.4037
Omidi K, Hooshyar M, Jessulat M, Samanfar B, Sanders M, Burnside D et al Phosphatase complex Pph3/Psy2 is involved in regulation of efficient non-homologous end-joining pathway in the yeast Saccharomyces cerevisiae. PloS one [Internet]. 2014 Jan 31;9(1):e87248–e87248. Available from: https://pubmed.ncbi.nlm.nih.gov/24498054
Baryshnikova A, Costanzo M, Kim Y, Ding H, Koh J, Toufighi K et al (2010) Quantitative analysis of fitness and genetic interactions in yeast on a genome scale. Nature Methods [Internet]. ;7(12):1017–24. Available from: https://doi.org/10.1038/nmeth.1534
Wagih O, Usaj M, Baryshnikova A, VanderSluis B, Kuzmin E, Costanzo M et al SGAtools: one-stop analysis and visualization of array-based genetic interaction screens. Nucleic acids research [Internet]. 2013/05/15. 2013 Jul;41(Web Server issue):W591–6. Available from: https://pubmed.ncbi.nlm.nih.gov/23677617
Pavitt GD, Ramaiah K, Kimball SR, Hinnebusch AG eIF2 independently binds two distinct eIF2B subcomplexes that catalyze and regulate guanine-nucleotide exchange. Genes & development [Internet]. 1998 Feb 15;12(4):514–26. Available from: https://pubmed.ncbi.nlm.nih.gov/9472020
Memarian N, Jessulat M, Alirezaie J, Mir-Rashed N, Xu J, Zareie M et al (2007) Colony size measurement of the yeast gene deletion strains for functional genomics. BMC Bioinformatics [Internet]. ;8(1):117. Available from: https://doi.org/10.1186/1471-2105-8-117
Liu S, Milne GT, Kuremsky JG, Fink GR, Leppla SH (2004 Nov;24(21):9487–97) Identification of the proteins required for biosynthesis of diphthamide, the target of bacterial ADP-ribosylating toxins on translation elongation factor 2. Molecular and cellular biology [Internet]. Available from: https://pubmed.ncbi.nlm.nih.gov/15485916
Shalev A, Valás̆ek L, Pise-Masison CA, Radonovich M, Phan L, Clayton J et al (2001) Saccharomyces cerevisiae Protein Pci8p and Human Protein eIF3e/Int-6 Interact with the eIF3 Core Complex by Binding to Cognate eIF3b Subunits *. Journal of Biological Chemistry [Internet]. Sep 14;276(37):34948–57. Available from: https://doi.org/10.1074/jbc.M102161200
Blewett NH, Goldstrohm AC (2012/08/13) A eukaryotic translation initiation factor 4E-binding protein promotes mRNA decapping and is required for PUF repression. Molecular and cellular biology [Internet]. 2012 Oct;32(20):4181–94. Available from: https://pubmed.ncbi.nlm.nih.gov/22890846
Anthony RA, Liebman SW (1995 Aug;140(4):1247–58) Alterations in ribosomal protein RPS28 can diversely affect translational accuracy in Saccharomyces cerevisiae. Genetics [Internet]. Available from: https://pubmed.ncbi.nlm.nih.gov/7498767
Berset C, Trachsel H, Altmann M (1998) The TOR (target of rapamycin) signal transduction pathway regulates the stability of translation initiation factor eIF4G in the yeast Saccharomyces cerevisiae. Proceedings of the National Academy of Sciences of the United States of America [Internet]. Apr 14;95(8):4264–9. Available from: https://pubmed.ncbi.nlm.nih.gov/9539725
Romero AM, Ramos-Alonso L, Alepuz P, Puig S, Martínez-Pastor MT (2020) Global translational repression induced by iron deficiency in yeast depends on the Gcn2/eIF2α pathway. Scientific Reports [Internet]. ;10(1):233. Available from: https://doi.org/10.1038/s41598-019-57132-0
Searfoss A, Dever TE, Wickner R (2001 Aug;21(15):4900–8) Linking the 3’ poly(A) tail to the subunit joining step of translation initiation: relations of Pab1p, eukaryotic translation initiation factor 5b (Fun12p), and Ski2p-Slh1p. Molecular and cellular biology [Internet]. Available from: https://pubmed.ncbi.nlm.nih.gov/11438647
Park Y-U, Hur H, Ka M, Kim J (2006 Dec;5(12):2120–7) Identification of translational regulation target genes during filamentous growth in Saccharomyces cerevisiae: regulatory role of Caf20 and Dhh1. Eukaryotic cell [Internet]. 2006/10/13. Available from: https://pubmed.ncbi.nlm.nih.gov/17041186
Costanzo M, Baryshnikova A, Bellay J, Kim Y, Spear ED, Sevier CS et al (2010) The genetic landscape of a cell. Science (New York, NY) [Internet]. Jan 22;327(5964):425–31. Available from: https://pubmed.ncbi.nlm.nih.gov/20093466
Omidi K, Jessulat M, Hooshyar M, Burnside D, Schoenrock A, Kazmirchuk T et al (2018) Uncharacterized ORF HUR1 influences the efficiency of non-homologous end-joining repair in Saccharomyces cerevisiae. Gene [Internet]. ;639:128–36. Available from: https://www.sciencedirect.com/science/article/pii/S0378111917308077
Mangus DA, Amrani N, Jacobson A (1998 Dec;18(12):7383–96) Pbp1p, a factor interacting with Saccharomyces cerevisiae poly(A)-binding protein, regulates polyadenylation. Molecular and cellular biology [Internet]. Available from: https://pubmed.ncbi.nlm.nih.gov/9819425
Qiaoning SFA, Eric G (2006) N-E, R CM. Ebs1p, a Negative Regulator of Gene Expression Controlled by the Upf Proteins in the Yeast Saccharomyces cerevisiae. Eukaryotic Cell [Internet]. Feb 1;5(2):301–12. Available from: https://doi.org/10.1128/EC.5.2.301-312.2006
Schütz P, Bumann M, Oberholzer AE, Bieniossek C, Trachsel H, Altmann M et al Crystal structure of the yeast eIF4A-eIF4G complex: An RNA-helicase controlled by protein–protein interactions. Proceedings of the National Academy of Sciences [Internet]. 2008 Jul 15;105(28):9564. Available from: http://www.pnas.org/content/105/28/9564.abstract
Henri J, Rispal D, Bayart E, van Tilbeurgh H, Séraphin B, Graille M (2010) Structural and functional insights into Saccharomyces cerevisiae Tpa1, a putative prolylhydroxylase influencing translation termination and transcription. The Journal of biological chemistry [Internet]. 2010/07/14. Oct 1;285(40):30767–78. Available from: https://pubmed.ncbi.nlm.nih.gov/20630870
Chen RE, Thorner J (2007 Aug;1773(8):1311–40) Function and regulation in MAPK signaling pathways: lessons learned from the yeast Saccharomyces cerevisiae. Biochimica et biophysica acta [Internet]. 2007/05/22. Available from: https://pubmed.ncbi.nlm.nih.gov/17604854
Dalla Venezia N, Vincent A, Marcel V, Catez F, Diaz J-J (2019) Emerging Role of Eukaryote Ribosomes in Translational Control. International journal of molecular sciences [Internet]. Mar 11;20(5):1226. Available from: https://pubmed.ncbi.nlm.nih.gov/30862090
Carroll JS, Munchel SE, Weis K (2011) The DExD/H box ATPase Dhh1 functions in translational repression, mRNA decay, and processing body dynamics. The Journal of cell biology [Internet]. 2011/08/15. Aug 22;194(4):527–37. Available from: https://pubmed.ncbi.nlm.nih.gov/21844211
Shepard KA, Gerber AP, Jambhekar A, Takizawa PA, Brown PO, Herschlag D et al (2003) Widespread cytoplasmic mRNA transport in yeast: identification of 22 bud-localized transcripts using DNA microarray analysis. Proceedings of the National Academy of Sciences of the United States of America [Internet]. 2003/09/17. Sep 30;100(20):11429–34. Available from: https://pubmed.ncbi.nlm.nih.gov/13679573
Boone C, Bussey H, Andrews BJ (2007) Exploring genetic interactions and networks with yeast. Nature Reviews Genetics [Internet]. ;8(6):437–49. Available from: https://doi.org/10.1038/nrg2085
Douglas AC, Smith AM, Sharifpoor S, Yan Z, Durbic T, Heisler LE et al (2012) Functional Analysis With a Barcoder Yeast Gene Overexpression System. G3 Genes|Genomes|Genetics [Internet]. Oct 1;2(10):1279–89. Available from: https://doi.org/10.1534/g3.112.003400
Baker RT, Williamson NA, Wettenhall REH The Yeast Homolog of Mammalian Ribosomal Protein S30 Is Expressed from a Duplicated Gene without a Ubiquitin-like Protein Fusion Sequence: EVOLUTIONARY IMPLICATIONS *. Journal of Biological Chemistry [Internet]. 1996 Jun 7;271(23):13549–55. Available from: https://doi.org/10.1074/jbc.271.23.13549
Tkach JM, Yimit A, Lee AY, Riffle M, Costanzo M, Jaschob D et al (2012 Sep;14(9):966–76) Dissecting DNA damage response pathways by analysing protein localization and abundance changes during DNA replication stress. Nature cell biology [Internet]. 2012/07/29. Available from: https://pubmed.ncbi.nlm.nih.gov/22842922

SupplementaryData.docx

Download PDF

Reviews received at journal
26 Jan, 2022
Reviewers invited by journal
07 Jan, 2022
Editor assigned by journal
06 Jan, 2022
First submitted to journal
04 Jan, 2022

You are reading this latest preprint version

Lithium Chloride Sensitivity Connects the Activity of PEX11 and RIM20 to PGM2 translation

Status:

Version 1

Abstract

Figures

1. Introduction:

2. Materials And Methods:

2.1 Strains and Plasmids

2.2 Media Inoculation

2.3 LiCl sensitivity analysis

2.4 mRNA quantification analysis

2.5 PGM2 Protein content measurement

2.6 Quantitative β-galactosidase Assay

2.7 Genetic Interaction Analysis

2.8 Genetic Interaction data Analysis

3. Results And Discussion:

3.1 Yeast tolerance to Lithium Chloride is eroded by gene deletions of PEX11 and RIM20

3.2 PGM2 Expression is Controlled at the Translational Level by PEX11 and RIM20.

3.4 Genetic Interaction Analysis Further Connects the Activity of PEX11 and RIM20 to Protein Biosynthesis

4. Concluding Remarks:

Declarations

References

Supplementary Files

Status:

Version 1