Animals
Twenty male wistar rats (180 ± 20 g) were purchased from Institute of Zoology, Chinese Academy of Sciences (Beijing, China). Rats were fed standard chow and water, and maintained under the light/dark cycle (12 h/12 h). This study was performed with the approval of our hospital Animal Ethics Committee.
LPS-induced ARDS model in rats
LPS-induced ARDS rat model was established by intratracheal instillation with 2 mg/kg LPS (Sigma-Aldrich, St. Louis, MO, USA) and were divided into ARDS, ARDS + sh-negative control (NC) and ARDS + sh-H19 group (5 rats in each group). ARDS rats were then intravenously injected with 2 × 107 TU/ml sh-H19 (ARDS + sh-H19 group) or 2 × 107 TU/ml sh-NC (ARDS + sh-NC group) at 48 h post LPS induction. After 24 h of treatment, rats were anesthetized with 50 mg/kg pentobarbital sodium and sacrificed by cervical dislacation. Sham group rats (n = 5) were intratracheally instilled with an equal volume of normal saline (NS). Blood samples, lung tissues and bronchoalveolar lavage fluid (BALF) were collected for the future experiments.
Histopathology detection by hematoxylin-eosin (HE) staining
Lung samples were fixed in 4% paraformaldehyde for 24 h, embedded in paraffin, cut into sections at 6 µm thickness, and stained with HE staining. By means of light microscopy, the histopathological change of lung tissues was observed. The histology score of lung tissues was evaluated as previously described [19].
Analysis of arterial blood gas and ratio of lung wet/dry (W/D) weight
Samples of arterial blood were obtained from carotid artery. Partial pressure of arterial oxygen (PaO2) and partial pressure of arterial carbon dioxide (PaCO2) were detected by automatic blood gas analyzer (Radiometer, Copenhagen, Denmark). Lungs were weighed and subsequently dried in a 60 °C oven for 72 hours. The ratio of lung W/D weight represented tissue edema.
Assay of BALF
BALF collection was performed through lavaging the lungs and airways three times with NS. The levels of total protein (TP), tumor necrosis factor-α (TNF-α), interleukin (IL)-1β and IL-6 in BALF were examined using enzyme-linked immunosorbent assay (ELISA) kits (R&D systems, Inc., Mineapolis, USA).
Cell culture
MH-S and MLE-12 cells were obtained from American Type Culture Collection (ATCC). All cell lines were cultured in Roswell Park Memorial Institute (RPMI)-1640 (GIBCO, Erie, NY, USA) with 10% fetal bovine serum (FBS, Invitrogen, Carlsbad, NY, USA) at 37 °C containing 5% CO2.
Cell transfection
The si-H19, si-NC, miR-423-5p inhibitor and inhibitor negative control (INC) were obtained from Shanghai Genepharma (Shanghai, China). MH-S and MLE-12 cells were stimulated with 100 ng/ml LPS for 24 h. Then, MH-S and MLE-12 cells were transfected with above agents using Lipofectamine 3000 reagent (Invitrogen).
Western blot
Lung tissues were lysed by ice-cold lysis buffer to obtain total protein. The concentrations of total protein were detected by bicinchoninic acid (BCA) protein concentration assay kit (Pierce, Rockford, IL, USA). Protein samples were separated in sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE), and transferred onto polyvinylidene fluoride (PVDF) membrane. Then membranes were incubated with primary antibody overnight at 4 °C. The antibodies used in this study were as follows: anti-β-actin (1:1000, ab8227, Abcam, Cambridge, MA, USA), anti-vimentin (1:1000, ab92547, Abcam), anti-α-smooth muscle actin (α-SMA) (1:1000, ab124964, Abcam) and anti-E-cadherin (1:1000, ab76319, Abcam). The membranes were then incubated with horseradish peroxidase (HRP)-labeled goat anti-rabbit IgG (1:5000, ab6712, Abcam) secondary antibody for 1 h at room temperature. Finally, the protein bands were visualized by enhanced chemiluminescence (ECL) exposure solution, and quantified by a gel imaging system (UVP, Upland, CA, USA). β-actin was introduced as the internal reference.
Quantitative real time polymerase chain reaction (qRT-PCR)
The expression of H19, miR-423-5p, TNF-α, IL-1β, IL-6, intercellular adhesion molecule (ICAM)-1, vascular cell adhesion molecule (VCAM)-1, monocyte chemoattractant protein (MCP)-1 and vascular endothelial growth factor (VEGF) was detected by qRT-PCR. The total RNA of cells and tissues was extracted using TRIZOL reagent (Invitrogen) and was reverse-transcribed into cDNA by Takara PrimeScript RT reagent kit (Takara, Otsu, Japan). PCR reaction was performed on ABI 7500HT Fast Real-Time PCR System (Applied Biosystems, Waltham, MA, USA) with the following conditions: 95 °C for 3 min, 40 cycles of 95 °C for 15 s and 60 °C for 30 s. Relative expression was calculated by the 2−ΔΔCt method. U6 and β-actin were used for the normalization. The primer sequences were shown in Table 1.
Table 1
Primer sequences used in quantitative real-time PCR
Name of primer | Sequences(5’-3’) |
VEGF-F | GTAACGATGAAGCCCTGGAGTG |
VEGF-R | CGTCTGCGGATCTTGGACAAAC |
β actin-F | TGCTGTCCCTGTATGCCTCTG |
β actin-R | CTTTGATGTCACGCACGATTT |
IL-6-F | GGAAATCGTGGAAATGAG |
IL-6-R | AGGACTCTGGCTTTGTCT |
IL-1β-F | GCCCTAAACAGATGAAGTGCTC |
IL-1β-R | GAACCAGCATCTTCCTCAG |
ICAM)-1-F | CAAACGGGAGATGAATGG |
ICAM-1-R | TGGCGGTAATAGGTGTAAAT |
VCAM-1-F | CGGTCATGGTCAAGTGTTTG |
VCAM-1-R | GAGATCCAGGGGAGATGTCA |
MCP-1-F | ATGCAGGTCTCTGTCACGCT |
MCP-1-R | GGTGCTGAAGTCCTTAGG |
H19-F | GAATTCAGTTAGAAAAAGCCCGGGCT |
H19-R | GCGGCCGCTTTGCTGTAACAGTGTTTATTG |
miR-423-5p-F | GGGAGCAAGATGGCGATTC |
miR-423-5p-R | CCCTCAAACTTCGGGCTTC |
U6-F | TGCGGGTGCTCGCTTCGGCAGC |
U6-R | CCAGTGCAGGGTCCGAGGT |
Note: VEGF: vascular endothelial growth factor; ICAM-1: intercellular adhesion molecule-1; VCAM-1: vascular cell adhesion molecule-1; (MCP)-1: monocyte chemoattractant protein-1. |
Immunohistochemistry
Sections of lung tissue were dewaxed in xylene, dehydrated in graded alcohol, and incubated in 3% H2O2 for 0.5 h. The sections were blocked with normal goat serum, followed by anti-vascular endothelial growth factor (VEGF) (1:100; ab185238, Abcam) antibody incubation. Then the sections were incubated with HRP-labeled goat-anti rabbit IgG (1:1000, ab6721, Abcam) secondary antibody. Immunohistochemistry was captured by a digital microscope (Nikon Eclipse 80i, Nikon, Tokyo, Japan).
Masson-trichrome staining
The 6-µm thickness paraffin-embedded tissues sections of lung were stained with masson-trichrome. The ratio of fibrotic area was observed using light microscopy and the fibrosis score was graded as previously described: 0, absent, appears normal (−); 1, light (+); 2, moderate (++); 3, strong (+++); 4, intense (++++) [20].
Dual-luciferase reporter assay
The potential binding sites of miR-423-5p and H19 were predicted according to StarBase3.0. The H19-Wt and H19-Mut were cloned and combined with psiCHECK-2 vectors (Promega, Madison, WI, USA). H19-Wt or H19-Mut was co-transfected with mimics-NC or miR-423-5p mimics (Shanghai Genepharma) into MLE-12 cells with Lipofectamine 3000 (Invitrogen). The luciferase activity was detected by Dual-luciferase reporter gene assay system (Promega).
Statistical analysis
Statistical analysis was performed with SPSS 23.0 (SPSS Inc., Chicago, IL, USA) and GraphPad Prism software 7.0 (San Diego, CA, USA). Data was presented as mean ± SD. The differences between various groups were analyzed by one-way ANOVA followed by the multiple comparisons test. The data of two groups were assessed using Student’s t-test. A P value < 0.05 was considered statistically significant.