Study design and area
A cross-sectional health facilities based study was conducted in Assosa Zone, Northwest Ethiopia from November to December 2018. Assosa Zone is one of the four Zonal administration in Benishangul-Gumuz Regional State and is located 687 km west of Addis Ababa, Ethiopia. Assosa Zone consists of eight woredas with majorities of the woreda is with high malaria transmission intensity based on annual parasite incidence conducted according to 2016/17 report of Health Information Management System from Benishangul-Gumuz regional state.
Study participants
The study participants were all self-presenting clinically suspected malaria patients, whose age were greater than or equal to 5 years, who were attending at four randomly selected health facilities: Assosa Health Centre, Bambasi Health Centre, Kurmuk Health Centre and Sherkole Health Centre. Individual with a history of antimalarial chemotherapy in the last month with severe illness were excluded.
Sample size determination and sampling procedure
Sample size calculations were performed based on single population proportion formula n = z2p (1-p)/d2[24]; where n = the sample size, z = 1.96 at 95% confidence interval (CI), d = margin of error, p = expected malaria prevalence rate in the locality which is 40% based on the assumption of a microscopy-confirmed prevalence of malaria among symptomatic patients according to 2015 the study[25], d = margin of error at 5% (standard value of 0.05). Subsequently, a total of 406 study participants were calculated and enrolled including 10% non-response rate in this study.
Four health facilities, Assosa Health Centre, Bambasi Health Centre, kurmuk Health Centre and Sherkole Health Centre were selected using simple random sampling technique among eight Health centers in the Assosa Zone. Then, allocation of the study participants to each selected health center was performed based on proportion of confirmed malaria case in each selected woreda, based on annual parasite incidence in 2016/17 report of Health Information Management System from Benishangul-Gumuz regional state [2].
Demographic data and collection of blood samples
Demographic data were collected using an interview-based structured questionnaire. Finger-prick blood sample was collected for direct preparation of thin and thick smear microscopy, Pf/PV based RDT( HRP-2/PLDH), Pf-based RDT( HRP-2/PLDH) and Dried blood spots (DBSs) on Whatman filter paper for molecular Assay. Methodological workflow is described in Fig 1.
Microscopic blood film examination
Both thick and thin blood smear were prepared on the same slide for each study participant. The thick film was performed to detect and measure the density of the parasite. Asexual parasite densities were determined against 200 white blood cells (WBC), assuming mean WBC count was 8,000/μL, as per the WHO recommendations[26]. The thin film was performed for species identification of malaria parasites. The thick and thin blood smear were stained with 10% buffer-diluted Giemsa stain working solution for 10min and examined by 100x oil immersion objective microscope. Standard operating procedures were used for specimen collection, processing and testing for maintaining a good quality data Each blood film was read by two independent medical laboratory technicians and there was no discrepancies in the result.
Malaria rapid diagnostic tests (RDTs)
The CareStartTM malaria RDTs (Pf/PV (HRP2/PLDH) Ag Combo RDT with Lot code MV 18C64, and Pf (HRP2/PLDH) Ag Combo RDT with Lot code MS 18H61) from Access Bio Ethiopia were used to evaluate their performance against microscopy as reference test. PLDH is specific for P.vivax and P.falciprum in MV18C64 and MS18H61 Lot, respectively. Briefly, malaria RDTs utilize immunochromatographic methods to detect parasite-specific antigens produced by malaria parasites. This method is lateral flow devices that uses colored antibody that binds to lysed parasite antigen and was carried by capillary action on a nitrocellulose strip and arrested by a capture antibody, resulting in a colored band on a test strip[27] . Each test was interpreted based on the manufacturer’s instructions in the package insert.
Molecular Assay
SYBR Green quantitative polymerase chain reaction (qPCR) assay was performed to correct discordant results such as false-positive and negative RDT results, and submicroscopic clinical samples. False positive RDT result is malaria suspected cases with a microscope confirmed negative result. False negative RDT result is malaria suspected cases with a microscope confirmed positive result.
Malaria parasite DNA was extracted from dried blood spots (DBS) using Chelex-Saponin method as describe previously [28]. SYBR Green quantitative PCR (qPCR) Assay were performed to amplify 18S rRNA gene for confirmation of P.falciparum using of a pair of forward and reverse primers sequence(P.falciparum-specific primers) :FAL-18S-F:AGTCATCTTTCGAGGTGACTTTTAGATTGCT and PLASMO-R2:GCCGCAAGCTCCACGCCTGGTGGTGC[29, 30]. For the quality control, DNA from P. falciparum isolates 7G8 (MRA-926) and HB3 (MRA-155) were used as positive controls, water and uninfected samples were used as a negative control in all amplifications . Briefly, qPCR amplification were carried out in the total reaction volume of 20μl containing 7μl Nuclease free water, 10μl of SYBR GREEN master mix, 0.5μl each of the forward and reverse primer, and 2 μl of extracted DNA under the following PCR cycling conditions: initial denaturation at 95°C for 3minutes, followed by 45 cycles amplification at 94°C for 30 seconds, 55°C for 30 seconds, and 68°C for 1minutes each.
Data quality assurance
Data collectors were trained, and close supervision was conducted during the data collection period. Standard operating procedures were used for specimen collection, processing and testing for maintaining a good quality data. Ten percent of samples were also randomly selected and rechecked blindly to ensure quality control
Data Analysis
The data were entered, cleaned and analyzed using Statistical Package for Social Sciences (SPSS) version 20. The diagnostic performance of malaria RDT against microscopic blood film and qPCR were assessed by calculating sensitivity, specificity and predictive values. The percentages of positive and negative infections were recorded and compared among these diagnostic methods. The agreement between these malaria diagnostic methods were assessed using with a kappa value.