Patients and samples
Fresh-frozen carcinoma tissues and adjacent normal tissues from CRC patients were obtained from Liaoning Cancer Hospital (Shenyang, China). Written informed consent was obtained from patients and the study protocol was approved by the Ethics Committee on Human Investigation of the Liaoning Cancer Hospital. Clinical details of the participants are shown in Table S1.
Cell culture
CRC cell lines (HCT116p53+/+, HCT116p53−/−, SW620 and HT29) were purchased from GeneChem (Shanghai, China), the human normal colon epithelial cell line (FHC) was purchased from ATCC (Manassas, USA), the cervical cancer cell line (HeLa) and the breast cancer cell line (MCF-7) were purchased from the Chinese National Infrastructure of Cell Line Resource (NICR) (Beijing, China). HCT116, SW620 and HeLa cells were cultured in RPMI-1640 medium (HyClone, Logan, USA). HT29 and MCF7 cells were cultured in high-glucose Dulbecco’s modified Eagle’s medium (DMEM) (HyClone, USA). Both media were supplemented with streptomycin (100 µg/ml), penicillin (100 units/ml) and 10% fetal bovine serum (FBS; ExCell Bio, China). FHC cells were cultured in complete DMEM: F-12 medium (ATCC, USA) according to the instructions. All cells were cultured at 37℃ in a humidified incubator containing 5% CO2.
RNA extraction from cells or tissues
Tissues were homogenized in 1 mL TRIzol reagent (Sigma, USA) and total RNA was extracted according to the manufacturer’s instructions. To extract cellular RNA, 3⋅105–5⋅105 cells were homogenized in 1 mL TRIzol reagent. PARIS TM kits (ThermoFisher, USA, Cat. No. AM1921) were used to isolate nuclear and cytoplasmic fractions from whole cells, and RNA was extracted from each fraction. Total RNA (1 µg) from each sample was reverse transcribed into cDNAs using PrimeScriptRT reagent kit with gDNA Eraser (TaKaRa, Japan).
Quantitative real-time PCR (qRT-PCR)
Gene expression was measured by qRT-PCR using iTaq Universal SYBR Green Supermix (Bio-Rad, USA) and performed on a CFX96TM real-time PCR system (Bio-Rad, USA). All PCR reactions were performed in triplicate under the following conditions: (1) initial denaturation at 95℃ for 2 min; (2) denaturation at 95℃ for 5 s; (3) anneal at 63℃ (SNORA24, U6 and SNHG8) or 57℃ (p53 and GAPDH) for 30 s; 40 cycles from (2) to (3). U6 and GAPDH were used as normalization controls, and the relative expression of target genes was calculated by the 2−ΔΔCt method. Sequences of the primers used for qRT-PCR are shown in Table S2.
Lentivirus infection
Lentiviruses (GV235) expressing SNORA24 (LV-SNORA24) or control oligonucleotide sequences (LV-control) were constructed by Shanghai JiKai Gene Medicine Technology Co., Ltd. (China). Lentiviruses (GV112) expressing shRNA sequences targeting SNORA24 (LV-SNORA24-KD) or negative control sequences (LV-NC) were purchased from the same company. Oligonucleotide sequences cloned into the vector were as follows:
Control (5'–3'): TTCTCCGAACGTGTCACGT;
SNORA24(5'–3'): (AgeI restriction endonuclease site) ACCGGTCTCCATGTATCTTTGGGACCTGTCAGCCGTGGCAGTCTCCCTTCCT
AGCCATGGAAGAGCATATCCTTGTTTATTGGCAAAGCTGTCACCATTTAATTGGTA
TCAGATTCTGACTTGCACAAGTAACATTCTTTTTTGAATTC
(EcoRI restriction endonuclease site).
ShRNA negative control (5'–3'): TTCTCCGAACGTGTCACGT;
ShRNA targeting SNORA24 (5'–3'): TATCTTTGGGACCTGTCAG.
Cells were cultured in 12-well plates (1.5⋅105 cells/well) for 24 h before infection with lentiviruses at a multiplicity of infection (MOI) of 10–20. 72 h later infection, cells were employed in further investigations or cultured in selection medium containing puromycin (2 µg/mL). Stably infected cells were maintained in medium containing puromycin (0.67 µg/mL).
Flow cytometry
Cell apoptosis was measured by flow cytometry (ACEA Bio, USA) using Annexin V-FITC apoptosis detection kits (Dojindo, Japan); 10 000 cells were analyzed for each sample and in triplicates for each group.
For cell cycle analysis, cells were fixed with 70% (v/v) ethanol at −20°C for approximately 24 h. Before flow cytometry detection, the fixed cells were washed twice with phosphate buffer solution (PBS), then stained with propidium iodide solution; 20 000 cells were analyzed for each sample and in triplicates for each group.
Cell proliferation assay
Cells were seeded in 96-well plates (2 000 cells/well) and proliferation was measured using Cell Counting Kit-8 (CCK-8) (Dojindo, Japan). The absorbance in each well was measured at 450 nm on a microplate reader (Sunrise, Tecan, Switzerland); five replicates were included for each group.
Colony formation assay
Cells were cultured in 6-well plates (500-1 000 cells/well)for 12–14 days and the medium was refreshed every 4 days. Finally, the colonies were fixed in anhydrous methanol for 30 min at room temperature, stained with Giemsa for 30 min, and colonies were counted using Image J software.
EdU incorporation assay
HCT116 cells stably infected with LV-SNORA24 or LV-control were seeded on coverslips in 6-well plates (3⋅105 cells/well). After 24 h, the cells were incubated with 10 µM EdU for 2 h at 37℃ in a humidified incubator. EdU was stained with Alexa Fluor 488 according to the manufacturer's instructions (Beyotime, China). The images were recorded by laser confocal microscopy imaging system NIKON TI2-E and CRESTIPTICS X-LIGHT V3 (Nikon, Japan).
Western blotting
Cellular protein extraction and western blotting were performed as previously described (Shen et al. 2018). The following antibodies were used in this study: anti-PARP (Cell Signaling Technology (CST), Massachusetts, USA; Cat. No. 9542S, 1:1 000), anti-caspase3 (CST, USA; Cat. No. 9662S, 1:1 000), anti-β-actin (Proteintech, Chicago, USA; Cat. No. 60008-1-lg, 1:2 000), anti-p53 (Santa Cruz, California, USA; Cat. No. sc-126, 1:1 000), anti-p21 (Santa Cruz, USA; Cat. No. sc-6246, 1:500), anti-CDK2 (Abcam, Cambridge, UK; Cat. No. ab32147, 1:1 000), anti-p-CDK2 (T160) (Abcam, UK; Cat. No. ab194868, 1:1 000), anti-cyclin E (Santa Cruz, USA; Cat. No. sc-248, 1:1 000), mouse horseradish peroxidase (HRP)-conjugated IgG (KPL, Gaithersburg, USA; Cat. No. 074-1806, 1:5 000), rabbit HRP-conjugated IgG (KPL, USA; Cat. No. 074-1516, 1:5 000). Protein bands were scanned using the Image Quant LAS 500 system (GE Healthcare, Chicago, USA).
Mouse tumor xenograft model
Female BABL/c nude mice (aged 4 – 5 weeks) were purchased from Vital River company (Beijing, China) and randomly divided into two groups: LV-SNORA24 group and LV-control group (n = 6 per group). HT29 and SW620 cells stably infected with LV-SNORA24 or LV-control were injected subcutaneously behind the thigh (approximately 1⋅107 cells/mouse). Mice were euthanized after continuous observation for 28 – 30 days. Tumor volume and weight were measured as described previously (Liu et al. 2020). The study protocol was approved by the Ethics Committee of the Academy of Military Medical Science (AMMS, Beijing, China).
Hematoxylin and eosin (H&E) and immunohistochemistry (IHC)
Paraffin-embedded xenograft tumor tissues were sliced into 3 µm sections. Histological analyses of the tumors were measured by staining with H&E and IHC.
The paraffin-embedded slides were first deparaffinized with xylene and then dehydrated with a graded series of alcohols, stained with H&E for histological analyses. Heat-mediated antigen retrieval was used in IHC assay, Ki-67 was strained with anti-Ki-67 (Abcam, UK; Cat. No. ab15580, 1:2 000) in conjunction with HRP-conjugated antibodies (ZSGB-BIO, China, Cat. No. PV-9001), and visualized with 3,3'-diaminobenzidine (DAB) substrate.
Bioinformatics database
Data for CRC patients were obtained from TCGA (https://portal.gdc.cancer.gov/). Expression profiles of SNORA24 and the data about 5-year overall survival of patients were obtained from the SNORic database (http://bioinfo.life.hust.edu.cn/SNORic). Data about the expression of SNORA24 in colorectal adenoma were obtained from the Gene Expression Omnibus (GEO) database (https://www.ncbi.nlm.nih.gov/geo/). The secondary molecular structure of SNORA24 was predicted by RNAfold WebServer (http://rna.tbi.univie.ac.at/cgi-bin/RNAWebSuite/RNAfold.cgi). Analysis of homology was performed using the UCSC database (https://genome.ucsc.edu). Analysis of data from RNA-sequencing using Metascape (https://metascape.org).
RNA-sequencing
HCT116 cells stably expressing LV-SNORA24 or LV-control were employed for RNA-sequencing (triplicates in each group) by LC-BIOTECHNOLOGIES CO., LTD. (Hangzhou, China) using an Illumina X10 sequencer. Differentially expressed genes were identified based on the following criterion: P < 0.05, log2(FC)>1 or log2(FC) <-1. The data were analyzed by Gene Ontology (GO) enrichment and protein-protein interaction prediction.
Cycloheximide (CHX) exposure
HCT116 and HT29 cells expressing LV-SNORA24 or LV-control were seeded in 6-well plate (5*10^5 cells/well). 24 hours later, cells were treated with 100 µg/mL CHX or dimethyl sulfoxide (DMSO) for 0, 1, 2, 4, 8 and 12 h.
Statistical analysis
Data were presented as the mean ± standard deviation (SD), all experiments were performed in triplicate or as three independent experiments. All qRT-PCR, CCK-8 assay, colony formation assay and flow cytometric data were analyzed by two-tailed Student’s t-test or two-way ANOVA. Data from CRC patient cohorts were analyzed by Chi-square (χ2) test, the Multiple Kaplan–Meier Plotter (KM-Plotter) and Cox proportional hazards (Coxph) regression model. P < 0.05 was set as the threshold for statistical significance.