Subjects
A total of 197 Uyghur subjects participated in and contributed blood and fecal samples to this study, where 98 of them newly diagnosed with T2DM according to ADA criteria (2014) and 99 served as healthy controls. All subjects come from the Endocrinology department and physical examination center of the firth affiliated hospital of Xinjiang medical university. Each participant gave written informed consent following a full description of the study, which was approved by the Ethics Committee of the first affiliated hospital of Xinjiang Medical University. The control group comprised 99 normal glucose tolerance subjects who were randomly selected and matched for age, gender to cases from the general population. We excluded those subjects who reported already having diabetes, receiving antidiabetic medicine (metformin, etc.), had antibiotic or drugs used to regulate intestinal flora (i.e. prebiotic, symbiotic, or probiotics) during the previous month, cardiovascular disease, kidney disease and cancer. Pregnant women, lactating women were not included in the study. Subjects who had pets at home were also excluded. People who had neurological impairments, and or severe mental illness were excluded.
Clinical measurements and laboratory study (anthropometrics)
The anthropometrics data of the subjects were collected using a designed questionnaire by professional staff, including general demographic data such as age, gender, occupation, education level, economic status, and chronic disease. Height, weight, waist circumference, hip circumference and blood pressure were measured, and body mass index (BMI) and waist-to-hip ratio (WHR) were calculated. Blood glucose (FPG, 2hPG), blood lipids (TC, TG, HDLC, LDLC) level were measured using automated analyzer. Plasma omentin-1 levels were determined by enzyme-linked immunosorbent assay (ELISA).
Genotyping study
Blood DNA was extracted by Tiangen genomic DNA exaction mini kit. Primers were designed by Shanghai Tianhao Genetic Analysis Co. The forward primer of rs2274907 was 5’- CCCTCACCCGAGTGGGTAAGAA -3’, and the reverse primer was 5’- AGTCAGCAGGGCAGCAAAGC-3’. The PCR reactions were conducted using the following program: 2min of denaturation at 95°C, 11 cycles of 20s at 94°C, 40s for annealing at 65°C, and 30s for elongation at 72°C, 24 cycles of 20s at 94°C, 30s for annealing at 59°C, and 30s for elongation at 72°C and a final extension at 72°C for 2min. PCR reactions were performed in triplicate 20μL mixture containing 4μL of 1×GC Buffer (TAKARA), 2μL of 2.0mM dNTPs,1μL of each primer (2μM), 0.4μL of HotStarTaq polymerase (Qiagen Inc.) and 1μL of template DNA. The resulted PCR products were extracted from a 2% agarose gel. PCR-RFLP was applied to determine the genotypes of Val109Asp variant (rs2274907) in the Omentin-1gene. In the RFLP test 20μL mixture containing 1μL restriction endonuclease,10µl PCR products, 2µl 1xbuffer and 7μl DNase free distilled water. One unit of restriction enzyme is the amount of enzyme required to digest 1μg of lambda DNA in 1h at 37°C for AccI. The digested product was diluted 10 times and applied to 3730 XL for capillary electrophoresis.
Real-time quantitative PCR (qPCR)
DNA was extracted from 200 mg of stool samples using a QIAamp DNA Stool Mini Kit (Qiagen, Hilden, Germany) following the manufacturer's instructions. Quantification of the bacterial species of interest in each original sample DNA was performed by qPCR using a (Bio-rad IQ5) Real-Time PCR System (Bio-rad, USA), and the primers and annealing temperatures are shown in Table S1. All the oligonucleotide primers were synthesized by Shenggong Co. (Shanghai, China). Amplification reactions contained 10 µL of SYBR Green PCR Master Mix (Applied Biosystems, Warrington, UK), 0.5µL each primer, and 0.5µL of the respective crude template DNA or water (negative control) in a final volume of 20 µL. Each reaction was performed in duplicate. Amplifications were performed under the following conditions: one cycle at 95°C for 3 min, 39 cycles of denaturation at 95°C for 30 s, annealing at different temperatures (Table S1) for 30 s, and extension at 72°C for 1 mins, followed by a final extension step at 72°C for 5 min. The copy number of rRNA gene operons of targeted bacteria in crude DNA templates was determined against serially diluted DNA standards. Bacterial quantity was expressed as log10 copies per mg total microbial DNA.
Statistical analysis
All the analyses were performed by using SPSS version 21. Sample characteristics were presented as mean values and standard deviations for continuous variables, and percentages for categorical variables. Baseline characteristics were compared between three groups by using the analysis of chi-square test (categorical variables) and t test (continuous variables). To assess Hardy-Weinberg equilibrium (HWE) for allele frequencies was examined by the chi-square test. Potential correlations between SNP and gut microbiota assessed using logistic regression models following adjustments for participant gender, BMI, and age. The risk for T2DM was evaluated by calculating the 95% confidence intervals (95% CIs) and odds ratios (ORs) and their corresponding P values. Comparisons with P<0.05 were considered significantly significant.