Animals
Male Sprague-Dawley rats (200–250 g) were purchased from the animal center of the Fourth Military Medical University (Xi'an, China). All experiments were approved by Animal Care and Use Committee of the Fourth Military Medical University and complied with the Declaration of the National Institutes of Health Guide for Care and Use of Laboratory Animals (Publication No. 85 − 23, revised 1985). To obtain pulmonary hypertension rats, rats were housed intermittently in a hypobaric hypoxia chamber depressurized to 380 mmHg (10% oxygen) and taken hypobaric hypoxia challenge of 8 h/d for 4 weeks. Age-matched rats were housed in room air (21% oxygen) accordingly.
Hemodynamic and Morphological Investigation
Right ventricular pressure and hematoxylin and eosin staining of lung and renal tissues were performed according to my published article [23]. After 4 weeks of hypoxia, the animals were anesthetized with 20% ethylurethanm (5 ml/ kg). Then, a soft silica gel catheter linked to a Power lab system (AD Instruments, Colorado Springs, CO, Australia) was inserted into the right jugular vein. The right ventricle peak systolic pressure (RVSP) waveforms were showed on the monitor when the catheter arrived in the right ventricle chamber. Meanwhile, the mean carotid artery pressure (mCAP) was recorded via a special catheter inserted into the carotid artery. After the weight of right ventricle (RV) and left ventricle plus septum (LV + S) were obtained, the ratio of RV/ (LV + S) was calculated as an index of RV hypertrophy. The right lung and kidney were placed in neutral buffer (pH 7.4) containing 10% formalin for 72 hours. The lung and kidney tissue were embedded in paraffin and sectioned into 5 µm thick sections, then processed hematoxylin and eosin staining. Microscopic evaluation showed structure remodeling of the pulmonary artery. Total 60 of pulmonary artery, bronchial artery and renal artery in approximate round shape were obtained from each group. Their external diameters are50-180 µm and the average size of artery was 78 µm. The outside diameter and inside diameter of pulmonary artery were measured by an image-processing program (Image-Pro Plus, Version 5.1, Media Cybernetics, Rockville, MD, USA). The medial wall thickness, the cross-sectional area of medial wall, and the total cross-sectional vessel area were obtained. Pulmonary vascular structure remodeling was assessed by percent medial wall thickness (MT %) and percent medial wall area (MA %) two indices: MT% = 100 × (medial wall thickness) / (vessel semi-diameter); MA% = 100 × (cross sectional medial wall area) / (total cross-sectional vessel area). All the morphological analysis was conducted via a double-blind method. The following should be explained in our experiment: pulmonary artery is a pulmonary circulatory vessel located in the pulmonary microenvironment, bronchial artery is a systemic circulatory vessel located in the pulmonary microenvironment, and renal artery is a systemic circulatory vessel not located in the pulmonary microenvironment.
Cell culture
AASMCs were used for systemic circulating vascular smooth muscle cells. Rat primary PASMCs and AASMCs were obtained by tissue explants culturing method according to my published articles [18]. Pulmonary artery (PA) and aortic artery(AA) were isolated from male Sprague-Dawley rats (200–250 g) and dissected into small pieces after the adventitial layers were removed, then placed in a overturned culture flask containing Dulbecco Eagle’s minimum essential Medium (DMEM, HyClone, Logan, UT) with 15% fetal bovine serum(FBS, CellMax, Beijing, China)at 37 °C in 21% oxygen condition. The flask was carefully turned over after 4 hours. PASMCs and AASMCs crawled out from the tissue in about a week. Cells were used between passages 3 to 6. Smooth muscle cell identity was verified by positive staining for smooth muscle a-actin (mouse monoclonal antibody, Sigma-Aldrich, St. Louis, MO, USA) at each passage.
Alveolar epithelial cells (AECs) in this study included rat primary ATII cells and RLE-6TN cells. Rat primary ATII cells were isolated from male SpragueDawley rats (180–200 g) as previously described [24]. Pooled cells from 2 rats were prepared as follows. Rats were injected intraperitoneally with 20% ethylurethanm (4 ml/kg) and intravenously 4000U/kg heparin sodium. Intubation of pulmonary artery and tracheal were performed. Rats were exsanguinated by cutting the abdominal aorta under the aseptic condition. 50 ml Solution II (in mM: 140 NaCl, 5 KCl, 10 Hepes, 2CaCl2, 2.5 PBS (pH 7.4), 1.3 MgSO4) was perfuse via the pulmonary artery to clear the vascular space of blood. The lungs were removed from the thorax and lavaged with 8 times solution I (10 ml/time) (in mM: 140NaCl, 5 KCl, 10 Hepes, 6 D-glucose, 2.5 PBS (pH 7.4),0.2 EDTA) and 2 times solution II (10 ml/time).Lungs were then filled 2 times with trypsin solution (10 ml/time) prepared in solution II and incubated in incubator for 10 min at 37℃ every time. The lungs were cut into pieces in the bottle with 4 ml DNAse I and 5 ml FBS. The lung tissues were then sequentially filtered through 125 µm and 75 µm stainless mesh. The filtrate was centrifuged at 1000r/min for 8 min. The cell pellet was resuspended in DMEM at 37℃.The cell suspension was plated at a density of 2 × 106 cells/ml in 25 cm2 bacteriologic plastic dishes coated rat IgG to remove macrophages and incubated at 37℃in 5% CO2 incubator for 1 h. The unattached cells in suspension were removed and centrifuged at 1000 r/min for 8 min. The cell pellet was plated at a density of 5 × 105 cells/cm2 in 6-well culture dishes with DMEM, 15% FBS, 100 U/ml penicillin and 100 U/ml streptomycin and incubated at 37℃under 5% CO2 incubator. The cell purity after 24 h was assessed by a characteristic fluorescence with phosphine3 Ras previously described [24]. RLE-6TN were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA) and maintained in DMEM supplemented with 15% FBS, 100 IU/ml penicillin and 100 mg/ml streptomycin.
The preparation of AECs culture medium
AECs were seeded in 24-well culture dishes at 5 × 103 cells per well under normoxic (21% O2) or hypoxic conditions (5% O2). Its culture medium was collected for 24 h to subsequent experiments.
Cell treatment
The effect of hypoxia on the proliferation of PASMCs and AASMCs was investigated under different oxygen concentrations. PASMCs or AASMCs were seeded in 96-well culture dishes at 3 × 104cells per well under normoxic (21% O2) or hypoxic conditions (10% O2 and 5% O2).
The effect of AECs on the proliferation of PASMCs and AASMCs was investigated using 24- well transwell insert co-culture model (0.4 µm pore). PASMCs or AASMCs were seeded in 24-well culture dishes at a density of 3 × 104cells per well, ATII or RLE-6TN were seeded in transwell inserts at a density of 1 × 104 cells per insert. The cells were maintained under normoxia (21% O2) or hypoxia conditions (5% O2). The cells were grouped as follows, PASMCs: (1) normoxia (2) hypoxia (3) normoxia, co-culture with ATII or RLE-6TN (4) hypoxia, co-culture with ATII or RLE-6TN (5) hypoxia, co-culture with ATII or RLE-6TN + NAC (10 mmol/L, a nonspecific ROS inhibitor, Sigma-Aldrich, St. Louis, MO); AASMCs: (1) normoxia (2) hypoxia (3) normoxia, co-culture with ATII or RLE-6TN (4) hypoxia, co-culture with ATII or RLE-6TN (5) hypoxia, co-culture with ATII or RLE-6TN + NAC (10 mmol/L).
To further confirm that AECs participated in the proliferation of PASMCs or AASMCs,the culture medium of PASMCs and AASMCs were replaced by AECs culture medium under normoxic or hypoxic conditions every 12 hours. The cells were grouped as follows, PASMCs: (1) normoxia (2) normoxia + ATII or RLE-6TN normoxic culture medium (3) normoxia + ATII or RLE-6TN hypoxic culture medium(4) hypoxia (5) hypoxia + ATII or RLE-6TN normoxic culture medium (6) hypoxia + ATII or RLE-6TN hypoxic culture medium; AASMCs: (1) normoxia (2) normoxia + ATII or RLE-6TN normoxic culture medium (3) normoxia + ATII or RLE-6TN hypoxic culture medium(4) hypoxia (5) hypoxia + ATII or RLE-6TN normoxic culture medium (6) hypoxia + ATII or RLE-6TN hypoxic culture medium.
To determine the effects of H2O2 on the proliferation of PASMCs or AASMCs, concentration- response was constructed by cumulative addition of exogenous H2O2 (5-1000 µM). The H2O2 concentration of the largest proliferation of PASMCs or AASMCs was selected and then treated with NAC to observe the change of proliferation.
MTT Assay
All cells were quiesced in serum-free medium for 24 hours after growing to subconfluence and then cultured with 5% fetal bovine serum for 48 hours under normoxic or hypoxic conditions. Subsequently, MTT (5 mg/mL) was added into the plates (80µL/well in 24-well plates or 20µL/well in 96-well plates) and incubated for another 4 hours. Dimethyl sulfoxide was added into each well, and all plates were shaken for 10 minutes in a shaker. The optical density (OD) values were collected using a spectrophotometer (PowerWave XS, BioTekInc, Winooski, VT).
Cell counting
To better investigate the effects of hypoxia on cell proliferation, direct cell counting was performed. Cells were seeded 6 × 104 cells in 6-well plates and cultured overnight. The cells were then incubated in serum-free for 24 h. Cells were cultured with normoxic (21% O2) or hypoxic conditions (10% O2 and 5% O2), and after 48 h they were washed with phosphate buffered solution, harvested by mild trypsinization, and counted with a hematocytometer.
qRT-PCR
qRT-PCR was performed with SYBR PrimeScript™ RT-PCR kit (TakaRa, Dalian, China). The total RNA of cells was extracted using Trizol (Invitrogen, Carlsbad, CA, USA). First-strand cDNA was synthesized from RNA.GAPDH was used as an internal control. Primer sequences were designed using the Primer Premier 5.0 software (PREMIER Biosoft International, CA, USA) and synthesized by the DNA Bio Tec (Shanghai, China).Primers sequences used were asfollows:forward:5’-TGGGAAACAACACCCCTATTTT-3’and reverse: 5’-CGAAGATACCACCAGTCGTAGTTG-3’for CAT; forward: CTGTGGCTGAGCTGTTGTAA and reverse: ACAGCGTCCAAGCAATTCAA for SOD2; forward: 5’-CTATCGGCAATGAG CGGTTC-3’and reverse: 5’–GATCTTGATCTTCATGGTGCTAGG-3’for GAPDH.
Measurement of ROS
PASMCs or AASMCs in N48, H48, H48 + NAC (10 mmol/L) groups were stained with an oxidant-sensitive fluorescence dye DCFH-DA (10 µmol/L, Nanjing Jian Cheng Bioengineering Institute, Nanjing, China). Subsequently, the intracellular total ROS were detected through fluorescence microscopy (Leica, Heidelberg, Germany) and flow cytometry.
Measurement of H2O2
The content of H2O2 in AECs and its culture medium were detected using a commercially available Hydrogen Peroxide Assay Kit (Beyotime Inc, Jiangsu, China) according to the recommended protocols. The concentrations of H2O2 in different groups were finally normalized to the corresponding protein concentrations.
Measurement of SOD
The content and activity of SOD in AECs was detected using a commercially Tatal Superoxide Dismutase Assay Kit with WST-8 (Beyotime Inc, Jiangsu, China) according to the recommended protocols. The content of SOD in different groups was finally normalized to the corresponding protein concentrations. The activity of SOD is calculated by the formula.
Isolated pulmonary artery ring preparation
Pulmonary artery and aortic artery were obtained according to published articles[25].Rats was anesthetized with 20% ethylurethanm (4 ml/kg). Lung and heart were removed and immersed into cold oxygenated Krebs-Henseleit solution (in mM: NaCl 127, KCl 4.7, NaHCO3 17, MgSO4 1.17, KH2PO4 1.18, CaCl2 2.5, D-glucose 5.5) after median sternotomy was performed. Under a dissecting microscope, the third-division (external diameter < 300 µm) pulmonary artery and aorta were isolated carefully and cleared of connective tissue and cut into 3-mm-length rings. Endothelium was removed by gently rubbing the lumen with swab in rings. Pulmonary ring and aorta ring were suspended respectively on stainless steel hook connected to force transducers (AD Instruments, Colorado Springs, CO) for isometric force recording in individual water jacketed organ chamber containing modified Krebs-Henseleit solutions parged continuously with 95% O2/5% CO2 at 37 °C. Force displacement was recorded with Power Lab (AD Instruments) eight-channel data acquisition system (sampling rate 100/s).
Experimental protocols
The pulmonary artery ring and aortic artery ring were stretched to a predetermined optimal passive tension of 500 mg and 1000 mg respectively and equilibrated for 60 min with three washouts at 20-min intervals. Then reproducibility of contractile responses to 1 µM phenylephrine (> 300 mg) was established. The rings were rinsed with Krebs-Henseleit solution and the tension returned to baseline. To determine the effects of H2O2 on the constriction of pulmonary artery and aortic artery, concentration-response curve was constructed by cumulative addition of exogenous H2O2 (5-1000 µM) at 10-min interval on ring. The H2O2 concentration of the largest contractile force of artery was selected and then treated with NAC after 10 min to observe the change of contractile force. To further confirm that AECs participated in the constriction of pulmonary artery and aortic artery, pulmonary artery ring and aortic ring from HPH and normoxic rats had treatment with AECs culture medium and NAC at 10-min intervals to observe the change of contractile force. The medium with 5% fetal bovine serum was used as a negative control. In the experiments involving NAC and H2O2, darkened conditions were employed where kymograph chambers were wrapped in foil with overhead lights switched off.For the vasoconstriction experiment, 1 µmol/L PE was used. Vascular ring contraction to maximum was labeled as 100%, the contraction data for each group was expressed as a percentage of the maximum contraction caused by 1 µmol/L PE.
Statistical analysis
Using SPSS 20.0 software to perform statistical analysis of the data, each group of data is represented by an average ± standard deviation (mean ± SD).And statistical analysis was assessed by analysis of variance (one-way ANOVA) for multiple group comparisons and pairing T test for two group comparisons. A significant difference was accepted as significant if P < 0.05.