Animal grouping and intervention
24 rats were randomly divided into normal control group, PPARγ agonist group, PPARγ inhibitor group and hypoxia injury group, with six rats in each group. PPARγ agonist group and PPARγ inhibitor group were given rosiglitazone 10mg/kg·d, GW9662,1mg/kg·d respectively, intraperitoneal injection three days before hypoxia until the end of the experiment. Normal control group did not receive any intervention treatment, and was given food or water. The other three groups were placed in the low-pressure and hypoxic animal chamber, and the simulated altitude in the chamber was raised to 7500 m (oxygen concentration was about 9.0%). The ambient temperature in the simulated cabin was 25 ± 2℃, the humidity was measured at 55%, and the subjects were given food and water in the cabin. After seven hours of hypoxia, the rats were put down. After the renal capsule and renal fascia were removed from the left kidney tissue, part of the tissue was placed in 4% paraformaldehyde for pathology, and the other part was placed at -80℃ for subsequent experiments.
Renal Histopathological Examination By Light Microscope And Transmission Electron Microscopy (Tem)
The kidney tissues of different parts, about the size of soybeans, were fixed with 10% neutral formalin and made into 3 ~ 4µm thick paraffin sections according to the conventional method. After staining with haematoxylin and eosin (HE), the kidney tissues were observed under ordinary light microscope. The lateral section of the removed left kidney was dissected, and the tissue with a diameter of 1µm was cut from the renal cortex. The tissue was fixed with 3.1% glutaraldehyde, bathed in buffer solution, fixed with 1% osmium acid, dehydrated by acetone and embedded with Epon812, and then prepared a semi-thin section. They were positioned under a light microscope, then cut into ultra-thin sections, dyed with uranium acetate and aluminum citrate, and observed under TEM.
Quantitative Real-time Fluorescent Pcr
Total RNA was extracted from kidney tissue by NucleoZOL (Macherey-Nagel, Germany), the mRNA was reversely transcribed into cDNA according to the instructions of TaKaRa reverse transcription kit, and amplified by ABI 7500 PCR machine. The primers were designed and synthesized by Sangon Bioengineering (Shanghai) Co., LTD., and their sequences are shown in Table 1. Total PCR reaction system: forward and reverse primer 0.4µL, Mix 10.0 µL, plate 2.0 µL, adding ddHO to 20.0 µL. Reaction conditions: 95 ℃, 30s, one cycle; 95 ℃, 10 s, 60 ℃, 30 s, 40 cycles; 95 ℃, 15s, 60 ℃, 60 s, 95 ℃, 15s, cycle once. The relative mRNA expression was normalized to β-actin and calculated using the 2−△△Ct formula.
Table 1
The real-time PCR primer of rat mRNA
| Gene | Forward primer (5’→3’) | Reverse primer (5’→3’) |
| PPARγ | CCATCGAGGACATCCAAGACAACC | GTGCTCTGTGACAATCTGCCTGAG |
| IL-1β | CTCACAGCAGCATCTCGACAAGAG | TCCACGGGCAAGACATAGGTAGC |
| ET-1 | TGCTCCTGCTCCTCCTTGATGG | TCGCTTAGACTTAGAAGGGCTTCC |
| SOD | CCACATCGGCCTGTGTATATCCCAG | CGTGAAGCTGGAGAAGGAGAAGCTG |
| Β-actin | AGTGTGACGTTGACATCCGTA | GCCAGAGCAGTAATCTCCTFCT |
Western blot analysis
Total protein was extracted from kidney tissue with protein lysate. After boiling and denaturation, 10 µg of protein was added to sample, and protein was isolated by sodium dodecyl sulfate polyacrylamide gel (SDS-PAGE). Protein was transferred to polyvinylidene fluoride (PVDF) membrane by wet transfer method. The membranes were blocked with 1×TBST containing 5% nonfat milk for 1.5 h at room temperature. Subsequently, the membrane was added with primary antibody PPARγ (1:1,000), IL-1β (1:1,000), ET-1 (1:1,500) and SOD (1:2,000) and incubated overnight in a refrigerator at 4 ℃. Washed the membrane with TBST three times for 10 minutes each. The membranes were added with horseradish peroxidase labeled secondary antibody (1∶5 000, SAB Company) and incubated at room temperature for 1.5 h and washed three times for 10 min each. The membrane was scanned using fluO-RChem ®HD2 imaging system and the results were analyzed using ImageJ software. The ratio of gray value of target protein band to gray value of internal reference β-actin protein band was used as the relative expression level of target protein.
Statistical analysis
Statistical analyses were carried out using the software package SPSS version 25. All experimental data are shown as the Mean ± The standard deviation. The significant differences between two groups were evaluated using the independent—samples test. Moreover, the significant differences among groups were examined using one-way analysis of variance (ANOVA) with post-hoc Fisher’s LSD, P < 0.05 was considered to indicate a statistically significance.