Cell culture
The human BMSCs from Procell Life Science & Technology Co. Ltd (Wuhan, China) were cultured in Dulbecco's modified Eagle's medium/Nutrient Mixture F-12 (F12/DMEM; Hyclone, Utah, USA) containing 10% fetal bovine serum (FBS; Gibco, Grand Island, USA). Bone marrow mesenchymal stem cells induced osteogenesis medium (Cyagen, Suzhou, China) was used to induce BMSCs osteogenic differentiation.
Alkaline phosphatase measurement and Alizarin Red S staining
The level of alkaline phosphatase (ALP) and osteogenic differentiation of human BMSCs was evaluated by ALP Determination Kit (Szybio, Wuhan, China) and Alizarin Red S reagent (Cyagen, Suzhou, China), respectively. BMSCs were washed with phosphate buffer solution three times and immobilized with paraformaldehyde for 30 min at room temperature. Later, paraformaldehyde was discarded and phosphate buffer solution was added for cleaning BMSCs again. BMSCs were stained by Alizarin Red S for 5 min, and then the images were captured under an inverted microscope (Olympus, Beijing, China).
iTRAQ quantitative proteomics analysis
The cells were fully lysed by cell lysate for 5 min, and cold acetone containing 10 mM dithiothreitol (DTT) was added. Next, centrifuge at 4°C, 13000 g for 20 min, the precipitates were collected and mixed with 800 μl cold acetone at 56°C to break the disulfide bond of the protein. Subsequently, centrifugation at 12000r/min for 20 min at 4 °C, the precipitate was dissolved with 100 μl TEAB dissolution buffer and then stored at -80 °C. Protein concentration was determined by the Bradford method. The protein was digested by trypsin, and 0.1% FA was added to acidify the digested protein. Peptides were purified on Strata-X C18 columns. Following activation and washing, these peptides were eluted and labeled.
The peptides were labeled according to the ITRAQ-8 standard Kit instructions (SCIEX, Massachusetts, USA) and mixed. Next, these labeled peptides were segregated via the Ultimate 3000 HPLC system (Thermo DINOEX, USA). Subsequently, the peptide samples were dissolved in buffer A (2% acetonitrile, 0.1% formic acid, 98% H2O) and analyzed by an Eksigent nanoLC-MS/MS (Triple TOF 5600 plus) system. The peptide solution was added to a C18 capture column (100 μm × 20 mm; 5 μm) and eluted at 300 nl/min on a C18 analytical column (75 μm × 150 mm; 3 μm) with a 90-min gradient. The two mobile phases are buffer A and buffer B (98% acetonitrile, 0.1% formic acid, 2% H2O).
Cell transfections and infection
When BMSCs in the logarithmic growth period were inoculated in 6-well plates and grew to 70% density, the supernatant was replaced with F12/DMEM medium containing different plasmids and siRNA without serum for transfection. According to the manufacturer’s instructions, TRX1 overexpression pcDNA3.1 plasmid (OE-TRX1) and negative control plasmids (OE-NC) were transfected into BMSCs by lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA), TRX1 siRNA (si-TRX1), and negative control siRNA (si-NC) were transfected by lipofectamine RNAiMAX (Invitrogen, USA). Subsequently, these BMSCs were cultured for subsequent experiments. These plasmids and siRNAs were obtained from Genecreate Biological Co. Ltd (Wuhan, China). The sequences were shown as follows: si-TRX1:GCUGCAGGUGAUAAACUUGUAUTT; si-NC:UUCUCCGAACGUGUCACGUTT.
Quantitative polymerase chain reaction (qPCR)
Total RNA was extracted by TRIzol reagent (Invitrogen, Carlsbad, CA, USA). Complementary deoxyribose nucleic acid (cDNA) was synthesized by using a reverse transcription kit (Toyobo, Osaka, Japan). Quantitative polymerase chain reaction (qPCR) was performed in an ABI Prism 7300HT Real-Time PCR amplification apparatus. The qPCR amplification procedure was as follows: Hot-Start DNA Polymerase activation at 95 ℃ for 1 min; denaturation at 95°C for 15s and extension at 60°C for 30s, with 40 cycles. Glyceraldehyde 3-phosphate dehydrogenase (GAPDH) served as the reference gene. The results were analyzed using DataAssist™ v3.0 software (ABI) with the 2-ΔΔCt method. The primer sequences for TRX1 are as follows: Forward: GCCTTGCAAAATGATCAACC, Reverse: ACCCACCTTTTGTCCCTTCT.
Western blot
Briefly, BMSCs were digested in a 1.5 ml EP tube with trypsin. Then, total proteins were extracted using a lysis buffer. The protein concentrations were estimated by the bicinchoninic acid method. Proteins were electrophoresed on 10% sodium dodecyl sulphate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred to polyvinylidene difluoride (PVDF) membranes. The membranes were then incubated with primary antibodies and secondary antibodies. Subsequently, the membranes were exposed after adding enhanced chemiluminescence plus reagent. All reagents on western blot were from Aspen Biotechnology Co. Ltd (Wuhan, China).
Animal and model establishment
Female balb/C mice (10 weeks), from the Department of Experimental Animals, Kunming Medical University, were reared under standard indoor conditions (temperature 22.1 ℃, humidity 55.5%). Animal experiments strictly followed the animal ethics guidelines of China's National Health and Medical Research Commission and were approved by the Ethics Committee of Kunming Medical University. These mice were randomly divided into three groups (8 mice in each group): sham-operated group (sham group), osteoporosis model group (OP group), melatonin treatment group (OP+melatonin group), negative control group (OP+melatonin+sh-NC group), and sh-TRX1 group (OP+melatonin+sh-TRX1 group. All mice were anesthetized with 5% pentobarbital (10 mg/kg). Mice were fixed in the prone position and disinfected with 75% alcohol after skin preparation. The back skin and peritoneum of mice were cut to expose the ovaries. After ovariectomy, the back skin was sutured by ligation with absorbable sutures. Anesthesia, fixation, and incision selection in the sham group were the same as those in the OP group, however, the ovaries were preserved and only the surrounding fat was removed. The melatonin group was given daily melatonin intragastric therapy (10 mg/kg) after ovariectomy. Mice in sh-NC and sh-TRX1 groups were injected 1.5×109 PFU/ml adenovirus containing sh-NC and sh-TRX1 through the tail vein. Later, these mice in the five groups were put into the cage and fed for 3 months.
Micro-CT analysis
After euthanasia, femurs in each group were fixed in formalin saline. Then Hiscan XM Micro CT with a 10 μm resolution was utilized to perform CT detection. The X-Ray tube settings of 80 kV and 100 uA were applied. The exposure time was set to 50 ms, and the scanning angle interval was 0.5. Hiscan Reconstruction software (Version 3.0) was used to reconstruct the image, and further evaluate bone mineral density (BMD), trabecular number (Tb.N), trabecular thickness (Tb.Th), and trabecular separation (Tb.Sp).
Statistical analysis
Prism 8.0 (GraphPad Software, San Diego, CA) was used for statistical analyses. All data were expressed as the mean ± SD, and a one-way analysis of variance (ANOVA) was used to compare data between different groups. P<0.05 indicated that the difference was statistically significant.