Animals
All experimental animals were group-housed with 2–5 animals per cage and maintained in a temperature- and humidity-controlled facility (23 ± 1°C, 55 ± 5% humidity) on a 12-h light/dark cycle at our animal care facility in the Center for Experimental Medicine of Juntendo University, Japan. All procedures involving animals were approved by the Ethics Review Committee for Animal Experimentation of the Juntendo University School of Medicine (rats: approval no. 288; mice: approval no. 1337) and followed the Principles of Laboratory Animal Care as outlined by the National Institutes of Health.
Study animals used in genetic identification included hydrocephalic H-Tx (H-Tx (+)) rats and non-hydrocephalic H-Tx (H-Tx (-)) rats at 18 days gestation (E18), 1 day postnatal (P1) and 1 week postnatal (P7), and Wistar and SD rats at P1. Among these, E18 H-Tx (+) and H-Tx (-) rats were determined from the size of the ventricles on tissue sections. P1 H-Tx (+) and H-Tx (-) rats were determined by the characteristic “domed head” appearance on gross examination (Additional file 1: Fig. S1A, B). H-Tx (-), Wistar and SD rats served as controls.
Animals were decapitated for dissection of the brain after induction of deep anesthesia using intraperitoneal pentobarbital (50 mg/kg body weight). Each brain sample was immediately stored in RNAlater® solution (AM7021; Thermo Fisher Scientific, Waltham, MA, USA) for DNA, RNA and protein extractions.
Identification of genetic risk in H-Tx rats
Comparative genomic hybridization array
DNA was extracted from the brain of H-Tx (+) rats and H-Tx (-) rats at E18, and genome-wide DNA copy number analysis was performed using a SurePrint G3 Rat Comparative genomic hybridization array (CGH) Microarray kit 1x1M SG13464375 (ID-027065; Agilent Technologies, Santa Clara, CA, USA) according to the protocol from the manufacturer. Data were extracted using Feature Extraction version 10.1.1.1 software (Agilent Technologies), and analyses were performed using Agilent Genomic Workbench Standard Edition version 5.0.14 software (Statistical algorithm ADM-2, threshold of 6.0, fuzzy zero correction). Non-redundant copy number abnormalities were called as a minimum of three consecutive probes and log2 ratio > 0.3 for gains and < -0.3 for losses were considered significant.
Real-time PCR of copy number
Copy number quantification was performed by TaqMan® quantitative polymerase chain reaction on the brain tissues of E18 H-Tx (+) and H-Tx (-) rats using an ABI7500 real-time PCR system (Applied Biosystems, Thermo Fisher Scientific). TaqMan Copy Number assays (Ptpn20 exon 6-7, Custom ID: CC70L9K, CCLJ15L) were run simultaneously with TaqMan Copy Number Reference assays (Rnase11 (Rn02349567_s1), Ftmt (Rn01492073_s1) and Hus1 (Rn02115575_s1)) (Applied Biosystems) according to the instructions from the manufacturers. Copy number variations were analyzed using ABI7500 software (Applied Biosystems) and Copy Caller version 2.0 software (Applied Biosystems).
Real-time PCR of Ptpn20 mRNA
Total RNA (500 ng) was converted into single-stranded cDNA using SuperScript™ IV VILO™ (SSIV VILO) Master Mix (Invitrogen, Thermo Fisher Scientific). The ABI 7500 Real-time PCR System (Applied Biosystems) and TaqMan® Gene Expression Assays (Applied Biosystems) were used according to the instructions from the manufacturer to quantify gene expression. Assay IDs are listed in additional file 5: Table S2.
Expressions of target genes were standardized to the expression of Actb. The presence of a single PCR amplicon was confirmed by melting curve analysis. Expressions of each gene in each sample were analyzed in triplicate.
Protein expression of Ptpn20
Proteins were extracted from CP (Additional file 6: Table S3) and lysed in 50 ml of lysis buffer (N-PER; Thermo Fischer Scientific) containing protease inhibitor cocktail (cOmplete ULTRA Mini EDTA-free EASYpack; Roche, Basel, Switzerland). Lysates were clarified by centrifugation at 20,000 g at 4°C for 10 min, and protein concentrations of the resultant supernatants were determined using BCA Protein Assay Kits (Thermo Fischer Scientific). After 10–15 µg of proteins was heated at 70°C for 10 min in NuPAGE® LDS Sample Buffer (NP0008; Invitrogen) and NuPAGE® Sample Reducing Agent (NP0009; Invitrogen), samples were electrophoresed on 4–12% NuPAGE® Bis-Tris Mini Gel by NuPAGE® MOPS SDS Running Buffer (20´) (NP0001; Invitrogen) Running Buffer (20´), then transferred to a polyvinylidene fluoride membrane. Primary antibodies are listed in additional file 6: Table S3. Signals were detected by chemiluminescence using a WesternBreeze kit (WB7103; Invitrogen). Immunoreactive bands were detected using ImageLab version 4.1 software (Bio-Rad Laboratories, Hercules, CA, USA).
Immunofluorescence of the CP
Animal brains were removed and postfixed with 4% paraformaldehyde in 0.01-M phosphate buffer (pH 7.2). Paraffin-embedded sections (4 µm) and cryosections (30 µm) were blocked with 5× SEA BLOCKTM blocking buffer (37527; Thermo Fisher Scientific) and 1% donkey serum in Phosphate buffered saline (PBS; AJ9P003; TaKaRa, Shiga, Japan) for 30 min, incubated in primary antibody overnight at 4°C and secondary antibodies for 60 min at room temperature. Vibratome sections (300 µm) were blocked using the same blocking buffer with 0.05% TritonX and 1% donkey serum in PBS for 30 min, then incubated in primary antibody for 2 days at 4°C and secondary antibodies for 2-h at room temperature. Primary and secondary antibodies are listed in additional file 7: Table S4. Nuclei in all sections were counterstained with ProLong Gold and SlowFade Gold Antifade Reagent with DAPI (4′,6-diamidino-2-phenylindole; P36935; Molecular Probes®, Invitrogen). Images were acquired with a confocal scanning microscope (TCS-SP5; Leica Microsystems, Wetzlar, Germany). Leica Application Suite Advanced Fluorescence Lite (Leica Microsystems) was used for image acquisition and processing.
Expression and role of Ptpn20 in mice
Immunohistochemistry
Brain and six other tissues (testis, kidney, heart, pancreas, liver and spleen) of 4-week-old C57BL/6J mice were fixed in 4% paraformaldehyde fixative (33111; Muto Pure Chemicals Co., Tokyo, Japan) for at least 1 week, embedded in paraffin, and cut into 6-µm sections. Endogenous peroxidase was blocked by incubation of brain sections with 0.3% hydrogen peroxide for 30 min. Sections were blocked with 5× SEA BLOCK Blocking Buffer and 1% donkey serum in PBS at 25°C for 30 min. Sections were incubated with rabbit PTPN20A antibody (CSB-PA199334, 1:50 dilution; CUSABIO, Houston, TX, USA) overnight at 4°C. The following day, sections were incubated with EnVision™ System Labeled Polymer (DAKO, Glostrup, Denmark) as the secondary antibody for 30 min at room temperature. Finally, sections were stained with 3,3'-diaminobenzidine and counterstained with Mayer’s hematoxylin, dehydrated, cleared, and mounted. Sections were viewed under an E800 microscope (Nikon, Tokyo, Japan) and images were captured with an AxioCam 506 color digital camera using AxioVison Rel version 4.7.2.0 image-processing software (Carl Zeiss Microimaging GmbH, Jena, Germany).
Generation of Ptpn20-knockout mice
Knockout mouse lines were generated using a CRISPR/Cas9 system in C57BL/6J mice with the single guide RNA (sgRNA) sequence (exon 4; CCTGAATCTCCGCAACTCTTTGC, underlinedis the protospacer adjacent motif sequence from GRCm38.p6).
Both sgRNA and Cas9 protein were injected into the cytoplasm of fertilized one-cell eggs using continuous pneumatic pressure. Eggs were cultured in modified Whitten’s medium for approximately 24 h and developed to 2-cell stage embryos. Two-cell stage embryos were transferred into each oviduct of pseudopregnant Institute of Cancer Research (ICR) recipient females that had been mated to vasectomized ICR male mice. Embryo transfer to pseudopregnant females was performed on the day the vaginal plug was detected. After birth, genomic DNA was extracted from tail tips of mutant F0 mice and subjected to PCR using primers. The band was evaluated for amounts of mismatch-digestion fragments. To verify the genotype of mice, PCR amplification was performed using AmpliTaqGold®360Mastert Mix (catalog no. 4398881; Thermo Fischer Scientific) from mouse DNA for sequencing. PCR primers were as follows: forward, 5'-ATA GAA CAG TCT AGC CGT AAC TCA C-3'; reverse, 5'-TTC CCA TCT TGG CTG CAT CAC-3'.
Genome DNA was extracted from mouse tails using a DNeasy Blood & Tissue Kit (Cat. no. 69506; Qiagen, Hilden, Germany). The primer sequence used to amplify exon 4 sequences by AmpliTaq GoldTM360Master Mix (no. 4398881; Thermo Fisher Scientific) was designed as follows: forward, 5'-TCA TGG ACA CTG AAA TAC AGG-3'; reverse, 5'-CTC TTA GAC CAT TGA CGC TAT T-3'.
Cycling conditions consisted of an initial 12-min denaturation step at 95°C followed by 35 cycles of 95°C for 30 s, annealing at 60°C for 30 s and extension at 72°C for 30 s, then final extension at 72°C for 7 min.
PCR products were sequenced on an ABI 3500 Genetic Analyzer using the BigDye Terminator Cycles Sequencing Kit v3.1 (Thermo Fisher Scientific). Samples were analyzed using Seq Scanner version 2 (Thermo Fisher Scientific) and compared with the public sequence in GenBank (NC_000080.6: Ptpn20).
Transmission electron microscopy of Ptpn20-knockout mice
Fresh brains from 8-week-old WT and Ptpn20-/- mice were perfused with 4% paraformaldehyde. Materials were immersed in 2.5% glutaraldehyde solution after being cut into smaller fragments for TEM (1´2 mm2). Samples were washed with PBS, post-fixed in 2% osmium tetroxide for 2-h at 4°C and dehydrated in graded concentrations of ethanol. For TEM, samples were placed in resin for 4 days at 60°C. Ultrathin sections were observed under an HT7700 electron microscope (Hitachi High-Technologies, Tokyo, Japan).
Measurement of the lateral ventricle
Fresh brains 8-week-old WT and Ptpn20-/- mice were postfixed in 4% paraformaldehyde for 72-h, equilibrated in 30% sucrose solution for 24-h at 4°C, then embedded in embedding matrix and frozen at -80°C for further use. Coronal sections of 30 μm were obtained using a freezing microtome and stained with HE according to standard methods. We viewed and photographed sections using the E800 microscope, and images were captured with an AxioCam 506 color Digital Camera using AxioVison Rel version 4.7.2.0 image-processing software.
Widths of the brain and lateral ventricles were measured on sections at 0.5 cm anterior to the bregma. The ratio of ventricular width to brain width (VBR) was used to determine the degree of ventricular dilatation.[22] Data were calculated as mean ± standard deviation for WT. Differences between WT and Ptpn20-/- mice were evaluated using the Mann-Whitney U test.
Ventricular injection of dye
Eight-week-old WT and Ptpn20-/- mice were deeply anesthetized by pentobarbital sodium (100 mg/kg; Kyoritsu Seiyaku, Tokyo, Japan). The head was fixed into a stereotaxic apparatus (Narishige Scientific Instrument Laboratory, Tokyo, Japan), and a small burr hole was drilled in the cranium on the right, 1 mm lateral to the bregma. The needle of a microsyringe (MS-10; Ito Corporation, Shizuoka, Japan) was slowly inserted into the lateral ventricle 4 mm from the brain surface through the hole and Evans blue dye (6 µl; FUJIFILM, Wako Pure Chemical Corporation, Osaka, Japan) was injected at 2 µl/min. Ten minutes after injection, mouse brains were harvested, fixed in 4% paraformaldehyde for 72-h, then cut into 1-mm-thick coronal slices.
Real-time PCR, immunoblot and immunofluorescence
These three methods are similar to those used in the first part, but the results in the second part of the real-time PCR were quantified using the 2-ΔΔCt method. Reagents are listed in additional file 5-7: Tables S2–4.
Statistical analysis
All experimental results are presented as mean ± standard deviation. Real-time PCR was performed as at least five independent experiments. Significant differences among groups were determined using Student’s t-test. Statistical differences of the lateral ventricle between WT and Ptpn20-/- mice were assessed by the Mann-Whitney U test. Results were considered statistically significant for values of P<0.05.