Dexamethasone can attenuate the inflammatory response in asthma via regulation of the lncH19/miR-324-3p cascade

doi:10.21203/rs.2.22494/v2

Download PDF

Research

Dexamethasone can attenuate the inflammatory response in asthma via regulation of the lncH19/miR-324-3p cascade

https://doi.org/10.21203/rs.2.22494/v2

This work is licensed under a CC BY 4.0 License

Journal Publication

published 07 Jan, 2021

Read the published version in Journal of Inflammation →

You are reading this older preprint version

Read the latest preprint version →

Objective: To investigate lncRNAs and their roles in regulating the inflammatory response under treatment of Dexamethasone (Dex) in asthma.

Methods: IL-1 beta (10 ng/ml) and LPS (1 μg/ml) was used to induce an inflammatory cell model with A549 cells, and the results showed that IL-1 beta performed better against LPS. Dex with different concentration was used to attenuate inflammation by IL-1 beta, and its effect was assessed by RT-PCR to detect the inflammatory related mRNA, including IKbeta-alpha, IKKbeta, IL-6, IL-8, and TNF-alpha and ELISA to detect the inflammatory cytokines TNF-alpha, IL-6 and IL-8. RT-PCR was used to quantify levels of lncRNAs, including lncMALAT1, lncHotair, lncH19, and lncNeat1. lncH19 was most closely correlated with the inflammatory response, which was induced by IL-1beta and attenuated by Dex, Among the lncRNAs, the level of lncH19 exhibited the highest increase following treatment with 1 μM and 10 μM Dex. Therefore, lncH19 was selected for further function study. lncH19 expression was inhibited by shRNA transduced by lentivirus. Cell assays for cell proliferation and apoptosis as well as RT-PCR, western blot, and ELISA for inflammatory related genes were conducted to confirm the functions of lncH19. Predicted target miRNAs of lncH19 included the following: hsa-miR-346, hsa-miR-324-3p, hsa-miR-18a-3p, hsa-miR-18b-5p, hsa-miR-146b-3p, hsa-miR-19b-3p, and hsa-miR-19a-3p. Following estimation by RT-PCR, hsa-miR-346, hsa-miR-18a-3p, hsa-miR-324-3p showed consistent patterns in A549 NC and A549 shlncH19. miRNA inhibitor was transfected into A549 NC and A549 shlncH19 cells, and expression levels were determined by RT-PCR. hsa-miR-324-3p was inhibited the most relative to hsa-miR-346 and hsa-miR-18a-3p and was subjected to further function study. RT-PCR, ELISA and Western Blot for inflammatory related genes detection were conducted to validate the functions of the target hsa-miR-324-3p.

Results: Dex with 1μM and 10 μM were shown to be effective in attenuating the inflammatory response. During this process, lncH19 significantly increased in expression (P < 0.05). Dex with 1μM was for further study. Under IL-1 beta treatment with or without Dex, the inhibition of lncH19 lead to an increase cell proliferation, a decrease in cell apoptosis, an increase in the protein level of inflammatory-related genes, and the phosphorylation of P65, ICAM-1, VCAM-1, and inflammatory cytokines. Following prediction of the targets of lncH19 and validation by RT-PCR, miR-346, miR-18a-3p, and miR-324-3p were found to be negatively correlated to lncH19. Additionally, Dex increased the expression of lncH19, but the expression of the aforementioned miRNAs was reduced. Among miRNAs, miR-324-3p was the most markedly down-regulated following treatment of miRNA inhibitors. The MTS assay and cell apoptosis assay showed that the miR-324-3p inhibitor inhibited cell proliferation and induced cell apoptosis, thereby significantly attenuating the inflammatory response, which reversed the effect of lncH19 in regulating cell proliferation and the secretion of inflammatory cytokines (P < 0.05). Therefore, lncH19 might regulate miR-324-3p during Dex treatment in inflammatory response of asthma.

Conclusion: Dex can attenuate the inflammatory response in asthma via regulation of the lncH19/miR-324-3p cascade.

Pharmacodynamics

Pulmonology

Asthma

inflammatory response

Dexamethasone

lncRNA

miRNA

Asthma is a type of chronic inflammation that affects a variety of cells, such as epithelial cells, eosinophils, mast cells, basophils, lymphocytes, and monocytes. It is also characterized by mucus hypersecretion, airway hyperresponsiveness (AHR), and airway remodeling [1, 2]. These pathognomonic features are primarily mediated by antigen-specific CD4+ T helper type 2 (Th2) cells and the corresponding cytokines IL-5, IL-6, IL-13, and IL-4 [2, 3]. Increased inflammatory cytokines in the airway epithelium, such as IL-8, IL-1 beta, and tumor necrosis factor-alpha (TNF-alpha), were also observed in asthma [4, 5]. These inflammatory cytokines are involved in inducing, prolonging and amplifying the inflammatory response by promoting the growth, proliferation and differentiation of eosinophils, promoting the generation of allergy-specific immunoglobulin E (IgE), and inducing AHR. Therefore, the inflammatory response is an important symptom associated with asthma. Inhaled corticosteroids are commonly used medicine to treat asthma [6]. WILSON, S. J. found that some of the therapeutic efficacy of inhaled corticosteroids was mediated through inhibition of NF-kappaB-regulated gene expression[7]. NF-kappaB is a transcription factor regulating many of the cytokine and adhesion molecule genes expressed in allergic inflammation, cytokine including colony-stimulating factor and TNF-alpha, adhesion molecules including intercellular adhesion molecule (ICAM)-1 vascular cell adhesion molecule-1 (VCAM-1) [7]. Dexamethasone (Dex) is representative of synthetic corticosteroids [6]. Epithelial cells play an active role in inflammation by the production of cytokines and other mediators and may, therefore represent an important site of glucocorticoid action[8]. A549 is alveolar type-II adenocarcinoma cell line, because it show physical characteristics in common with human bronchial epithelial cell, many studies use this cell to study the mechanism of asthma [9-11]. The inflammatory cell model of asthma were induced by IL-1 beta and lipopolysaccharides(LPS) in this study with reference to previous studies[11-13].

Long non-coding RNAs (lncRNAs) are newly discovered RNAs, which are defined as RNA molecules with lengths that exceed 200 nt. lncRNAs are involved in many biological processes, such as cell growth, differentiation, the cell cycle, and the progress and metastasis of cancer [14, 15]. Much research has suggested that the abnormal expression of lncRNAs in human diseases is often due to the regulation of inflammatory cytokines, such as NF-kappaB [16]. Depending on their targets, lncRNAs can act as regulators for different biological processes. Therefore, we hypothesized that specific lncRNAs might regulate the pathologic processes underlying asthma.

In this study, we targeted specific lncRNAs that have been reported to be correlated with the inflammatory response to characterize their mechanistic roles in the inflammatory response in asthma. The inflammatory response was induced by IL-1 beta and LPS using previously described methods in A549 [11-13] and was then attenuated using Dex. We quantified changes in lncRNA expression during treatment of IL-1 beta with Dex in A549 cells. We also determined the functional roles of candidate lncRNAs in regulating the inflammatory response under treatment of Dex in asthma. Because the functions of lncRNAs are usually performed by targeting miRNAs, we identified the miRNA targets of lncRNAs as well as quantified their expression levels to characterize their functions.

Cell culture and treatment

A549 were obtained from the Shanghai Cell Bank (Shanghai, China) and were cultured at 37℃ with 5% CO₂. Cells were maintained on DMEM high-glucose culture medium with 10% fetal bovine serum (Gibco, USA). Cells were cultured, amplified, and passaged. After 3 days, cells were digested and pelleted by centrifuge. Cell morphology was observed using a light microscope and suspended at a concentration of 1 × 10⁶/ml. For inflammatory cell model, IL-1 beta (peprotech, USA) with 10ng/ml or LPS (sigma, USA ) with 1 μg/ml was added and reached for 8 hours, 16 hours, 24 hours. For the effect of Dex, Dex (sigma, USA ) with different concentration (10nM, 100nM, 1000nM, 10000nM) and IL-1 beta with 10ng/ml were added at the same time for 24 hours, for the functions of lncH19 and miR-324-3p, IL-1 beta with 10ng/ml and Dex with 1 μM were added at the same time, the cells and supernatant were harvested for further studies.

MTS assay

Cells were at a density of 1 × 10⁶/ml, and 100 μl/well were seeded into 96-well plates. IL-1 beta with 10ng/ml was applied to cells with or without Dex(1 μM) for 24 hours after transfection with or without miRNA inhibitor for 24 hours. Cells were examined at 1, 2, and 3 day. MTS was added. After 3 hours incubation, the optical density of the cells was detected at 490 nm.

Cell apoptosis assay

5 × 10⁵ cells/well were seeded in 6-well plates overnight at 37℃. After treatment, cells were then pelleted and washed with PBS. 1× binding buffer was used to resuspend the cells, 5 μl 7-AAD staining solution and 5 μl of APC-conjugated Annexin V were then added. Samples were tested using a FACSCalibur flow cytometer, and the percentage of apoptotic cells was measured.

Lentivirus preparation and infection

LncH19 sequence come from NCBI with the number NR_002196.2. The antisense sequence of lncH19 (5'- CGGCAAGAAGCGGGTCTGTTTCTTT-3') was synthesized and was cloned to the LV3 vector together with the inverted repeat sequence. The empty vector LV3 was used as a control. The lentivirus solution was prepared by Shanghai Majorbio, China. A549 cells were seeded in 96-well plates at a density of 3 × 10⁴ cells/well. Virus solution was diluted in a 10× gradient at five different concentrations with DMEM medium. The supernatant with culture medium was discarded from each well and supplemented with 100 μl of the virus solution at a different concentration in each well. Saline solution, instead of a virus solution, was used as a control. Cells were incubated at 37℃ with 5% CO₂ for 24 hours. The cell culture supernatant was replaced with fresh prepared 100 μl DMEM medium. Cells were then incubated for 72 hours. RT-PCR was performed to detect the expression of lncH19. miRNA inhibitor and the negative control were transfected using lipofetamine 3000 per the manufacturer’s protocol (Thermo Fisher, USA).

ELISA assay to detect inflammatory cytokines

Cytokine concentrations in the cell culture supernate were determined using an ELISA kit for TNF-alpha, IL-6, and IL-8 (Cusabio, Wuhan, China). Briefly, 96-well plates were precoated with TNF-alpha-, IL-6- and IL-8-specific human antibodies, and human TNF-alpha, IL-6, and IL-8 were used for the standard titration curve. Samples and standards were added and incubated for 120 minutes at 37℃. Biotin-labeled antibody was added and incubated for 60 minutes at 37℃. After washing three times, HRP-avidin was added, and samples were then incubated for 60 minutes at 37℃. Following three washes, TMB substrate was added, and samples were incubated for 25 minutes at 37℃ and protected from light. Stop solution was added, and photospectrometry was performed at 450 nm.

RT-PCR

mRNAs of the inflammatory related gene, including IKbeta-alpha, IKKbeta, IL-6, IL-8, and TNF-alpha, lncRNAs and miRNAs were verified by RT-PCR. M-MLV Reverse Transcriptase (Promega, USA) was used to synthesize cDNA. PCR reactions were prepared with GoTaq qPCR Master Mix (Promega, USA) and performed on an ABI 7500 system (Applied Biosystem, USA). The PCR program was as follows, 95℃ for 30 seconds, followed by 40 cycles of 95℃ for 5 seconds, and then 60℃ for 30 seconds. The housekeeping genes GAPDH and U6 were used to normalize expression levels. Primers are shown in Table 1.

Western blotting

Cells were lysed in 1% SDS lysis buffer. The BCA assay was used to determine protein concentrations. 10% SDS-PAGE was used to separate the protein. Protein was then transferred onto polyvinylidene fluoride membranes. Nonfat milk in PBS was used to block the membrane at room temperature for 1 hours. The membrane was incubated overnight at 4℃ with primary antibody (p-P65 abcam (ab76302), P65 CST (8242), ICAM-1 Santa Cruz (sc-107), VCAM-1 Santa Cruz (sc-13160), GAPDH Transgen (HC301)). After several washes with PBS, membranes were incubated in blocking buffer with a secondary antibody coupled to horseradish peroxidase for 2 hours at room temperature. The complexes were formed on the membrane, and the membrane was then detected by ECLplus (Amersham Biosciences/GE Healthcare, Velizy, France).

Statistical analysis

The data are presented as the mean±standard deviation (SD), N=3. The unpaired Student’s t-test and one-way analysis of variance (ANOVA) were used to analyze differences between two groups and multiple groups respectively. p< 0.05 was considered to indicate a statistically significant difference. GraphPad Prism software 7.0 was used for statistical analysis.

Dex attenuates the inflammatory response

To investigate the effect of Dex, we induced the inflammatory cell model with IL-1beta and LPS. A549 cells were applied for the assay and treated with IL-1beta at 10 ng/ml or LPS at 1 μg/ml in DMEM culture medium. Cells incubated with the reagents after 8, 16 and 24 hours were collected, and total RNA was isolated. RT-PCR was conducted to confirm the expression of the inflammatory related mRNA, including IKbeta-alpha, IKKbeta, IL-6, IL-8, and TNF-alpha. Generally, the results showed that IL-1beta performed better against LPS, as the mRNA levels of most of the inflammatory cytokines, aside from IL-6 and TNF-alpha, were significantly up-regulated at 8 hours; in addition, mRNA levels of all other cytokines were 2- to 4-fold greater at 24 hours (Fig 1A). The secretary cytokines in the cell culture medium, including IL-6, IL-8, and TNF-alpha, were determined by ELISA. The results were consistent in showing that IL-1beta was generally more effective, and the effect can be observed at 8 hours (Fig 1B). Therefore, we decided to use IL-1beta for 24 hours incubation to induce the asthma cell model.

Following the same principle, we used the cell model to characterize the effect of Dex. We incubated A549 cells with IL-1beta and Dex at different concentrations, ranging from 10 nM to 10000 nM at 24 hours. As before, RT-PCR and ELISA were used to evaluate the effect of Dex. mRNA levels of inflammatory related genes, including IKbeta-alpha, IKKbeta, IL-6, IL-8, and TNF-alpha, significantly increased following treatment with IL-1beta (P < 0.05). After adding Dex, the mRNA level was reduced to baseline levels, indicating that supplementation with Dex can attenuate the inflammatory response (Fig 2A). With respect to the secretary inflammatory cytokines, the concentration of IL-6, IL-8, and TNF-alpha increased significantly following treatment with IL-1beta relative to the control group. However, when cells were supplemented with Dex, the concentration of cytokines decreased, and Dex at both 1 uM and 10 uM significantly decreased in concentration (Fig 2B). Therefore, these observations suggest that Dex plays a role in attenuating the inflammatory response.

Verification of the lncRNAs involved in inflammation attenuation

Based on our preliminary findings, we targeted four lncRNAs, lncMALAT1, lncHotair, lncH19, and lncNeat1 to determine which of these lncRNAs are involved in processes underlying inflammation attenuation [17-20]. RT-PCR was conducted to determine lncRNA levels following treatment with IL-1 beta and Dex. The results show that the four candidate lncRNAs were down-regulated following treatment with IL-1 beta; however, lncRNA levels increased following supplementation with Dex (Fig 3). In general, lncRNA levels can be most clearly observed by the treatment of Dex at 1 μM and 10 μM (P < 0.05). Among the lncRNAs, the level of lncH19 exhibited the highest increase, approximately 2-fold, following treatment with 1 μM and 10 μM Dex. Therefore, lncH19 and Dex with 1 μM was selected for further function validation.

To verify the functions of lncH19, the corresponding shRNA was designed and infected to A549 cells by lentivirus. The performance of the specific shRNA was assessed by RT-PCR. Depending on the effect of the specific shRNA, lncH19 expression decreased by 50% (Fig 4A). The cells were then treated with IL-1beta and Dex (1 μM) to investigate the effect of decreasing the expression of lncH19. Cell proliferation was assessed via the MTS assay. Treatment of 1 μM Dex clearly inhibited cell proliferation, which might only be a side effect. When the expression of lncH19 was induced, cell proliferation increased relative to IL-1beta-treated cells lacking lncH19 inhibition with or without Dex (Fig 4B). We then further validated the functions of lncH19 via the flowcytometry cell apoptosis assay. Compared to the percentage of apoptotic cells with and without Dex treatment, apoptotic cells increased approximately 2-fold when Dex was applied. Cell apoptosis was inhibited and reduced by 30–50% relative to IL-1beta-treated samples lacking lncH19 inhibition with or without Dex (Fig 4C & 4D). Western blotting was conducted to determine the protein level of the genes that might be involved in the inflammatory response, including P65, p-P65, ICAM-1, and VCAM-1. The protein level of P65 did not change. For the rest of the genes, supplementation of Dex clearly decreased protein levels, but inhibition of lncH19 can also increase protein levels (Fig 4E). Therefore, given the consistency of these results with those obtained via flowcytometry and the MTS assay, the proteins p-P65, ICAM-1, and VCAM-1 are likely involved in the regulation of Dex. The cell culture supernatant was then collected, and the concentration of inflammatory cytokines, including IL-6, IL-8, and TNF-alpha was determined. Cytokines decreased in concentration by approximately 50% following the addition of Dex. Moreover, the inhibition of lncH19 increased the concentration of inflammatory cytokines (Fig 4F). Therefore, Dex can attenuate the inflammatory response, and lncH19 plays an important role in inflammatory processes.

Validation of candidate miRNAs regulated by lncH19

Miranda v3.3a has been used to predict the target miRNAs of lncH19. miRNAs are presented in Table 2. Because expression of lncH19 was up-regulated following addition of Dex and because up-regulation of lncRNA tends to result in the down-regulation of miRNAs, we searched for down-regulated miRNAs following addition of Dex. miR-346, miR-18a-3p, and miR-324-3p were down-regulated and were therefore chosen for further validation (Fig 5). The corresponding miRNA inhibitors were designed and transfected to A549 cells. The performance of the inhibitors was assessed via RT-PCR. For both miR-18a-3p and miR-324-3p, the corresponding inhibitors clearly decreased the expression of miRNAs by ~50%. The inhibitor of miR-324-3p was significantly more effective relative to that of miR-18a-3p (Fig 6A). Therefore, we further investigated the functions of miR-324-3p and divided into four groups, the first group, shNC+IL-1 beta+Dex+miRNA NC, abbreviated as NC+miRNA NC, the second group, shNC+IL-1 beta+Dex+miR-324-3p inhibitor, abbreviated as NC+miR-324-3p inhibitor, the third group, shlncH19+IL-1 beta+Dex+miRNA NC, abbreviated as shlncH19+miRNA NC, the fourth group, shlncH19+IL-1 beta+Dex+miR-324-3p inhibitor, abbreviated as shlncH19+miR-324-3p inhibitor. An MTS assay was conducted to assess cell proliferation. By comparing the NC+miRNA NC group to NC+miR-324-3p inhibitor group, cell proliferation increased significantly at 72 hours (P < 0.05). When cells were infected with shRNA targeting lncH19, cell proliferation increased from an OD value of 1.5 to 2.0 relative to NC+miRNA NC group. Cell proliferation was lower in shlncH19+miR-324-3p inhibitor,group compare to shlncH19+miRNA NC(Fig 6B). Therefore, the evidence suggests that the expression of lncH19 inhibited cell proliferation, but the expression of miR-324-3p promoted cell proliferation. We also conducted cell apoptosis assays via flowcytometry to determine the functions of miR-324-3p. The inhibition of lncH19 reduced apoptotic cells by ~30%, but inhibition of miR-324-3p clearly enhanced cell apoptosis relative to the NC+miRNA NC group (Fig 6C). mRNA levels of IkBalpha, Ikkbeta, IL-6, IL-8, and TNF-alpha were all up-regulated when lncH19 was inhibited but down-regulated when miR-324-3p was simultaneously inhibited relative to the NC+miRNA NC group (Fig 6D). The cell culture supernatant was collected to determine the concentration of the cytokines IL-6, IL-8, and TNF-alpha. The concentration of cytokines increased significantly when lncH19 was inhibited by shRNA relative to the NC+miRNA NC group. However, the concentration of cytokines decreased significantly when the expression of miR-324-3p was simultaneously inhibited, indicating that the inflammatory response was suppressed (Fig 6E). Western blotting was performed to determine the protein levels of inflammation-related genes, including p-P65, P65, ICAM-1, and VCAM-1. There was no significant change in the protein level of P65. Inhibition of lncH19 increased the protein levels of p-P65, ICAM-1, and VCAM-1 relative to the NC+miRNA NC group. However, protein levels were decreased when miR-324-3p was down-regulated by an inhibitor simultaneously. These findings suggest that miR-324-3p is involved in lncH19 regulation. lncH19 might target and inhibit the expression of miR-324-3p and thereby regulate inflammation.

In this study, IL-1beta-induced inflammatory A549 cells were attenuated by Dex to aid the study of lncRNAs. Initially, we targeted lncMALAT1, lncHotair, lncH19, and lncNeat1 and evaluated their expression levels. The results showed that lncH19 was most closely correlated with symptoms of inflammation, as its expression decreased following addition of IL-1beta to cells but increased following supplementation of Dex. The expression of lncH19 was negatively correlated with miR-324-3p. We showed that Dex attenuates the inflammatory effect by targeting a cascade involving lncH19 and miR-324-3p.

lncH19 was discovered in the 11p15.5, H19/IGF2 locus [21]. lncH19 is highly expressed in the fetus but begins to be silenced after birth with its expression restricted to a few tissues, such as the mammary gland, uterus and adrenal gland [22]. Current research suggests that mutation of H19 in mouse zygotes causes prenatal lethality, indicating that H19 plays an important role in cell growth and development [23]. Therefore, our findings are consistent with previous studies in that lncH19 is able to regulate cell activities, such as cell proliferation and cell apoptosis. Previously, lncH19 has been shown to be correlated with the NF-kappaB pathway and is thus involved in the regulation of cell growth in multiple myeloma [16]. NF-kappaB is an important family of transcription factors involved in cell differentiation, apoptosis and immunity. Activation of the NF-kappaB pathway is involved in most cell activities in cancer transformation, such as the inhibition of cell differentiation and cell apoptosis, promotion of cell proliferation, angiogenesis and potential metastasis [24]. Currently, NF-kappaB also plays a role in the anti-inflammatory effects in asthma [7,24], which suggests that it can provide an important pathway for lncH19 targets and regulate the processes underlying the inflammatory effects of asthma. Induction of the inflammatory response by IL-1 beta reduced the expression of lncH19. However, supplementation of Dex, which can attenuate the inflammatory response, significantly increased the expression of lncH19. The up-regulation of lncH19 expression is correlated with the attenuation of asthma; therefore, lncH19 is likely involved in anti-inflammatory processes associated with asthma. However, since lncRNAs usually inhibit targets, lncH19 might not directly target NF-kappaB. Therefore, we suspected that lncH19 targets and inhibits NF-kappaB and possibly other anti-inflammatory factors.

Further study of lncH19 revealed that the expression of miR-346, miR-17a-3p, and miR-324-3p were inhibited by lncH19 over-expression. Following detection of cell proliferation and cell apoptosis, inhibition of miR-324-3p revealed a highly significant correlation between cell proliferation and apoptosis. Therefore, we suspected that lncH19 regulates the inflammatory response by regulating miR-324-3p. miR-324-3p is a commonly expressed miRNA that regulates processes underlying cancer. The main target of miR-324-3p is SMAD7. According to Xu et al., the miR-324-3p/SMAD7 axis played a significant role in regulating cell growth and apoptosis in nasopharyngeal cancer [25]. Overexpression of SMAD7 is associated with the development of skin, pancreatic, lung, and colon cancer in the processes of cell growth and apoptosis [26]. Previous studies have shown that SMAD7 is correlated with the NF-kappaB pathway and therefore regulates the cell cycle in cancers [27]. Inflammatory often changed the expression of p65, ICAM-1, and VCAM-1 [7]. Their expression levels can be used as indicators of the inflammatory response. Previous studies have also shown that p65 is associated with the activation of NF-kappaB [7]. By characterizing the expression of the aforementioned cytokines, we have confirmed that both lncH19 and miR-324-3p could be important factors in regulating the inflammatory response. Therefore, regulation of the inflammatory response might be achieved through the regulation of SMAD7/NF-kappaB pathways via a regulatory network between lncH19 and miR-324-3p in which lncH19 targets miR-324-3p. However, this proposed regulatory cascade requires further validation for future.

Our results have shown that Dex can attenuate the inflammatory response in asthma. The lncH19/miR-324-3p axis might play an important role in regulating the inflammatory response and thus cell proliferation and cell apoptosis. Future studies should examine additional genes targets of the lncH19/miR-324-3p axis, including SMAD7 and NF-kappaB, to further elucidate the regulatory processes associated with the lncH19/miR-324-3p axis. Furthermore, the expression of lncH19/miR-324-3p should be quantified in animal model and actual asthma patients before and after the use of corticosteroids, the anti-inflammatory effect of Dex in asthma are regulated by the lncH19/miR324-3p pathways in animal model, the correlation between lncH19 and miR-324-3p expression changes in asthma is also what we would need to study in the future, as our hypothesized mechanism is based on a A549 cell model. Data from actual patients are important for confirming the functions of the lncH19/miR-324-3p cascade and could contribute to asthma diagnoses as well as the development of therapeutic approaches to treat asthma. We can also search for possible ncRNAs by RNA-seq technology, because lncRNA may also interact with other ncRNAs.

In summary, we demonstrated here for the fist time that Dex can attenuate the inflammatory response in asthma via regulation of the lncH19/miR-324-3p cascade. The present study indicated that lncH19/miR-324-3p cascade maybe contribute to asthma diagnoses as well as the development of therapeutic approaches to treat asthma in patient.

Acknowledgments

The authors are grateful to Feng Xu, who provided technical assistance with aspects of this work.

Authors’ contributions

Conceived and designed the experiments: FX, YC, CZ, performed the experiments: CGX, XDL, analyzed the data: FX, CGX, XDL, contributed reagents/materials/analysis tools: FX, ZLH, wrote the paper: YC, CZ. All authors read and approved the final manuscript.

Funding

Not available.

Availability of data and materials

All data generated or analyzed during this study are included in this published article.

Ethics approval and consent to participate

All procedures were conducted according to the protocols and guidlines approved by Ethics Committee of Children’s Hospital of Chongqing Medical Universityand were performed following the declaration of Helsinki.

Consent for publication

Not applicable.

Competing interests

The authors declare that they have no competing interests.

Authors' information

Not available.

Hamid Q, Tulic M. Immunobiology of asthma. Annual review of physiology, 2009, 71: 489-507.
Wills-Karp M. Immunologic basis of antigen-induced airway hyperresponsiveness. Annual review of immunology, 1999, 17(1): 255-281.
Larché M, Robinson D S, Kay A B. The role of T lymphocytes in the pathogenesis of asthma. Journal of Allergy and Clinical Immunology, 2003, 111(3): 450-463.
Charrad, R., Kaabachi, W., Rafrafi, A., et al, & Hamzaoui, A. IL-8 Gene Variants and Expression in Childhood Asthma. Lung, 2017, 195(6):749-757.
Hunter, C. A., Jones, S. A. IL-6 as a keystone cytokine in health and disease. Nature Immunology, 2015, 16(5): 448–457.
Kraft M, Lewis C, Pham D, et al. IL-4, IL-13, and dexamethasone augment fibroblast proliferation in asthma. Journal of allergy and clinical immunology, 2001, 107(4): 602-606.
WILSON, S. J., WALLIN, A., DELLA-CIOPPA, G., et al. Effects of Budesonide and Formoterol on NF-κB, Adhesion Molecules, and Cytokines in Asthma. American Journal of Respiratory and Critical Care Medicine, 2001, 164(6): 1047–1052.
Devalia, J. L., Davies, R. J. Airway epithelial cells and mediators of inflammation. Respiratory Medicine, 1993, 87(6): 405–408.
Mason, R. J., Williams, M. C. Phospholipid composition and ultrastructure of A549 cells and other cultured pulmonary epithelial cells of presumed type II cell origin. Biochimica et Biophysica Acta (BBA) - Lipids and Lipid Metabolism, 1980, 617(1): 36–50.
Hsieh, C.-C., Liu, K.-F., et al. Comparing the Protection Imparted by Different Fraction Extracts of Garlic (Allium sativum L.) against Der p–Induced Allergic Airway Inflammation in Mice. International Journal of Molecular Sciences, 2019, 20(19): 4879.
Zhang, Y., Willis-Owen, S. A. G., et al. The ORMDL3 Asthma Gene Regulates ICAM1 and has Multiple Effects on Cellular Inflammation. American Journal of Respiratory and Critical Care Medicine. 2018, doi:10.1164/rccm.201803-0438oc.
King E M, Chivers J E, Rider C F, et al. Glucocorticoid repression of inflammatory gene expression shows differential responsiveness by transactivation-and transrepression-dependent mechanisms. PloS one, 2013, 8(1):e53936-.
Liu Z , Chen X , Wu Q , et al. miR-125b inhibits goblet cell differentiation in allergic airway inflammation by targeting SPDEF. European Journal of Pharmacology, 2016, 782:14-20.
Spizzo R, Almeida M I, Colombatti A, et al. Long non-coding RNAs and cancer: a new frontier of translational research?. Oncogene, 2012, 31(43): 4577-4587.
Wilusz J E, Sunwoo H, Spector D L. Long noncoding RNAs: functional surprises from the RNA world. Genes & development, 2009, 23(13): 1494-1504.
Sun Y, Pan J, Zhang N, et al. Knockdown of long non-coding RNA H19 inhibits multiple myeloma cell growth via NF-κB pathway. Scientific reports, 2017, 7(1): 1-10.
Zhou, H.-J., Wang, L.-Q., Wang, D.-B., et al. Long noncoding RNA MALAT1 contributes to inflammatory response of microglia following spinal cord injury via the modulation of a miR-199b/IKKβ/NF-κB signaling pathway. American Journal of Physiology-Cell Physiology, 2018, 315(1): C52–C61.
Zhang, H., Wei, Q., Wang, S., et al. LncRNA HOTAIR alleviates rheumatoid arthritis by targeting miR-138 and inactivating NF-κB pathway, International Immunopharmacology, 2017, 50: 283–290.
Han, Y., Ma, J., Wang, J., et al. Silencing of H19 inhibits the adipogenesis and inflammation response in ox-LDL-treated Raw264.7 cells by up-regulating miR-130b, Molecular Immunology, 2018, 93: 107–114.
Zhang, P., Cao, L., Zhou, R., et al. The lncRNA Neat1 promotes activation of inflammasomes in macrophages. Nature Communications, 2019,10(1). doi:10.1038/s41467-019-09482-6.
Chu M, Yuan W, Wu S, et al. Quantitative assessment of polymorphisms in H19 lncRNA and cancer risk: a meta-analysis of 13,392 cases and 18,893 controls. Oncotarget, 2016, 7(48): 78631.
Pachnis V, Belayew A, Tilghman S M. Locus unlinked to alpha-fetoprotein under the control of the murine raf and Rif genes. Proceedings of the National Academy of Sciences, 1984, 81(17): 5523-5527.
Brunkow M E, Tilghman S M. Ectopic expression of the H19 gene in mice causes prenatal lethality. Genes & development, 1991, 5(6): 1092-1101.
Imbert V, Peyron J F. NF-κB in hematological malignancies. Biomedicines, 2017, 5(2): 27.
Xu J, Ai Q, Cao H, et al. MiR-185-3p and miR-324-3p predict radiosensitivity of nasopharyngeal carcinoma and modulate cancer cell growth and apoptosis by targeting SMAD7. Medical science monitor: international medical journal of experimental and clinical research, 2015, 21: 2828.
A Briones-Orta M, C Tecalco-Cruz A, Sosa-Garrocho M, et al. Inhibitory Smad7: emerging roles in health and disease. Current molecular pharmacology, 2011, 4(2): 141-153.
He Y, Zhang J M, Xu L L, et al. Aberrant TNFAIP3 Induces Mesenchymal Stem Cell Impairment Via the NF-kB/SMAD7 Signaling Pathway in Immune Thrombocytopenia. 2016: 364-364.

Name	sequence(5’-3’)
H-IL-6-F	ACTCACCTCTTCAGAACGAATTG
H-IL-6-R	CCATCTTTGGAAGGTTCAGGTTG
H-IL-8-F	GACCACACTGCGCCAACAC
H-IL-8-R	CTTCTCCACAACCCTCTGCAC
TNF-α-F	CTGCACTTTGGAGTGATCGG
TNF-α-R	GCTTGAGGGTTTGCTACAACAT
H-Iκκβ-F	CGATGGCACAATCAGGAAACAGGT
H-Iκκβ-R	ATTGGGGTGGGTCAGCCTTCTC
H-IKB-α-F	ACACCTTGCCTGTGAGCAGG
H-IKB-α-R	AGCACCCAAGGACACCAAAA
β-Actin-F	CATGTACGTTGCTATCCAGGC
β-Actin-R	CTCCTTAATGTCACGCACGAT
H-lncMALAT1-F	AAAGTCCGCCATTTTGCCAC
H-lncMALAT1-R	ACAACTCGCATCACCGGAAT
H-lncHotair-F	GCAGTGGGGAACTCTGACTC
H-lncHotair-R	TTGAGAGCACCTCCGGGATA
H-lncH19-F	GACATCTGGAGTCTGGCAGG
H-lncH19-R	CTGCCACGTCCTGTAACCAA
H-lncNeat1-F	GGCAGGTCTAGTTTGGGCAT
H-lncNeat1-R	CCTCATCCCTCCCAGTACCA
hsa-mir-346-RT	GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCCGCTC
hsa-mir-346-F	GGTCTCTGTGTTGGGCGTCT
hsa-miR-18a-3p-RT	GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCCAGAA
hsa-miR-18a-3p-F	ACTGCCCTAAGTGCTCCTT
hsa-mir-324-3p-RT	GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCCAGCA
hsa-mir-324-3p -F	CCCACTGCCCCAGGTGCT
hsa-miR-146b-5p-RT	GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACACCAGA
hsa-miR-146b-5p-F	GCCCTGTGGACTCAGTT
hsa-miR-18b-5p-RT	GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACCTAACT
hsa-miR-18b-5p-F	GCGTAAGGTGCATCTAGTGCAG
hsa-mir-19a-RT	GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCAGTT
hsa-mir-19a-F	TGTGCAAATCTATGCAAA
hsa-miR-19b-3p-RT	GTCGTATCCAGTGCAGGGTCCGAGGTATTCGCACTGGATACGACTCAGTT
hsa-miR-19b-3p-F	GTGTGCAAATCCATGCAA
Universe-R	GTGCAGGGTCCGAGGT
U6-F	CGCTTCGGCAGCACATATAC
U6-R	CGAATTTGCGTGTCATCCTTG

Table 1Primers of mRNA, lncRNA, and miRNA.

lncRNA	miRNA	numBindingSitesPredicted	numTargetsPer100bp	specificBindingSitesPredicted
NR_002196.2	hsa-miR-346	5	0.22	252;435;579;887;1114
NR_002196.2	hsa-miR-324-3p	5	0.22	569;580;723;831;1103
NR_002196.2	hsa-miR-18a-3p	3	0.13	577;674;828
NR_002196.2	hsa-miR-18b-5p	2	0.09	137;1667
NR_002196.2	hsa-miR-146b-3p	2	0.09	257;746
NR_002196.2	hsa-miR-19b-3p	1	0.04	2023
NR_002196.2	hsa-miR-19a-3p	1	0.04	2034

Table 2Prediction of the target miRNAs of lncH19.

Download PDF

Journal Publication

published 07 Jan, 2021

Read the published version in Journal of Inflammation →

Editorial decision: Major revision
07 Jul, 2020
Review #1 received at journal
02 Jun, 2020
Review #2 received at journal
02 Jun, 2020
Reviewers invited by journal
26 May, 2020
Reviewer #1 agreed at journal
26 May, 2020
Reviewer #2 agreed at journal
26 May, 2020
Editor assigned by journal
24 May, 2020
Submission checks completed at journal
23 May, 2020
Editor invited by journal
23 May, 2020

You are reading this older preprint version

Read the latest preprint version →

Dexamethasone can attenuate the inflammatory response in asthma via regulation of the lncH19/miR-324-3p cascade

Status:

Journal Publication

Version 2

Abstract

Figures

Introduction

Materials And Methods

Results

Discussion

Conclusion

Declarations

References

Tables

Status:

Journal Publication

Version 2