Antibodies and Drugs
The primary antibodies used in this study are listed in Table 1. Emodin was obtained from Shanghai Base Industry (Shanghai, China) and dissolved in Tween-80, which was from Sinopharm Chemical Reagent Co., Ltd (Beijing, China). Anti-rabbit or anti-mouse IgG conjugated to [email protected] (800CW) (1:10,000) was from Lincoln (USA). Toluidine blue and dimethyl sulfoxide (DMSO) were from Sigma (St. Louis, MO, USA). Diaminobenzidine (DAB) tetrachloride system was from Beijing Zhongshan Jinqiao BioteChinaology Co., Ltd. (Beijing, China). The miR139-5p inhibitor was from RiboBio Co.,Ltd. (Guangzhou, China). 3’-UTR of 5-LO was amplified with the following primers: forward 5’-CGGGGTCTACAGTGCACGT-3’, reverse 5’- CTCAACTGGTGTCGTGGAGTC -3’.
Cell Culture and Transfection
N2a cells were cultured with 45% DMEMhigh glucose medium and 45% Opti-MEM® I Reduced Serum Medium and supplemented with 10% fetal bovine serum (FBS), 100 U/ml penicillin, 0.1 mg/ml streptomycin (all from Hyclone) at 37°C in the presence of 5% CO2. Transfection was performed with neofect (Neofect Biotechnology, Beijing, China) when cells were cultured to 70%~80% confluence in six-well plates. 48 hours after transfection, cells were collected and lysed for further research. HEK293 cells were cultured in high-glucose DMEM added with 10% FBS, 100 U/ml penicillin, 0.1 mg/ml streptomycin (all from Hyclone). Cells were incubated at 37 °C in a humidified atmosphere of 5% CO2. HEK293 transfection was performed using Lipofectamine 2000 (Invitrogen, Carlsbad, California, USA).
Animals
8-week-old male Sprague-Dawley rats were supplied by Experimental Animal Central of Tongji Medical College, Huazhong University of Science and Technology (Wuhan, China). All efforts were made to minimize animal suffering and to reduce the number of rats used and all experimental procedures in this research have been approved by the Animal Care and Use Committee of Huazhong University of Science and Technology. Rats were housed 5 per cage in temperature controlled rooms (26 ± 2 °C) with standard rodent chow and water available ad libitum, keeping on a standard 12 hours light or dark cycle with the light on from 7:00 a.m. to 7:00 p.m. All rats were evaluated by Sucrose Preference Test (SPT), Forced Swimming Test (FST) and Open Field Test (OFT) before the expreiments. The behavioral tests were performed during the light cycle in a dedicated sound-proof behavioral facility by experimenters blind to treatment information. Rats were brought to the procedure room 1 hour before the start of behavioral test and remained in the same room through the test. At all times, the sound was masked with 60-65 dB white noises.
In the first part of this research (Fig. 1a), 45 rats were used, of which 15 rats were randomly chosen as control (Ctrl) rats, and 30 rats were daily exposed for 7 weeks’ CUMS as reported[21, 22]. Depressed (Dep) rats were defined as those whose sucrose water intake decreased by more than 30% in SPT and their resting time increased by 50% during FST. Depression resistant (Res) rats were manifested as those having a greater sucrose water intake than the lower endpoint of the 95% confidence interval of that of control rats in SPT and a shorter immobility time than the upper endpoint of the 95% confidence interval of that of control rats in FST. After 7 weeks of CUMS exposure, 13 rats were in Res group and 14 rats were in Dep group, and the other 3 rats did not fit either group (Fig. 1a).
In the second part (Fig. 3a), we screened out depression susceptible rats (DeS) and stress insensitive rats (Ins) at the end of 5th week during 7 weeks’ CUMS exposure. A DeS rat was defined as who has a more than 20% decrease in sucrose water intake in SPT. An Ins rat should have a greater sucrose water intake than the lower endpoint of the 95% confidence interval of that of control rats in SPT. In 64 CUMS exposed rats, 28 rats showed stress insensitive and 30 rats showed depression susceptible. Then, we treated control (Ctrl) and DeS rats with emodin (intragastric administration, 80mg/kg) or the same volume of solvent (Veh) daily (Fig. 3a). The dosage of emodin was referenced from previous studies[20, 23].
CUMS
The procedure of 7 weeks’ CUMS exposure was performed as previously [21, 22]. Briefly, all stress-exposed rats were subjected to 3 or 4 following stressors each day, such as water or food deprivation for 24 hours, empty water bottles for 2 hours, cold room (4 °C) for 2 hours, hot room (45 °C) for 15 minutes, cage tilt for 16 hours, continuous overnight lighting for 12 hours, soiled cage (200 ml of water spilled onto the bedding) for 12 hours, grouped housing in one cage (4-5 per cage) for 12 hours, strobe lighting (200 flashes/minute) for 4 hours, intermittent white noise (85 dB) for 6 hours. The procedure was repeated for 7 weeks. The Ctrl rats were left undisturbed throughout with the exception of general handling (i.e., regular cage cleaning, water or food deprivation for SPT, and measuring body weight). Every week, SPT and weight weighing were performed.
SPT
SPT consists of 7 days of training phase, 24 hours of food and water deprivation phase, and 1 hour of testing phase. As previously, we trained the rat to consume 1.5% water sucrose solution for 1 hour (9:30 am-10:30 am) every day to adapt to novelty in the training phase. Then, the rat was deprived of food and water for 24 hours. In testing phase, rats were allowed free access to two pre-weighed bottles (containing water or 1.5% sucrose solution) for 1 hour. The sucrose preference was calculated as a percentage sucrose consumption × 100/ (water consumption + sucrose consumption).
OFT
The test was performed in a bare square box with 100 cm of length, 100 cm of width and 40 cm of height. As previously described[21], each rat were placed in the center of a black floor with 25 equal squares (20 cm × 20 cm square) including 16 peripheral squares and 9 central squares. The activity of rats was recorded by an overhanging camera linking to a computer over a 5 minutes’ period. The number of total squares a rat crossing in the arena defined as the number of zones crossing was analyzed as measures of locomotor activity. The rearings were taken as measures of anxiety. The box was cleaned with 75% alcohol between tests.
FST
Next, rats were tested in a transparent plexiglas cylinders (20 cm of diameter, 50 cm of deepth, filled with 23-25 °C water to a depth of 25 cm) as previously[22]. As previously described [22], rats were individually forced to swim for 5 minutes. Each session was videotaped for analysis and the water was changed between sessions. The duration of immobility in 5 minutes was measured. The floating vertically in the water and making only those movements necessary to maintain the head above the surface of the water for living were both considered as immobility. The immobility time was used for assessing feeling of hopelessness in rats.
Proteomic Analysis
The hippocampal proteomic analysis was conducted as previously described[21, 22, 24]. Briefly, the hippocampal proteins were extracted, digested and labeled by iTRAQ-6plex reagents in accordance with the manufacturer’s protocol. Then, the peptides were fractionated by high pH reverse-phase HPLC. The resulting fractions were dissolved, loaded onto a reversed-phase pre-column (Acclaim PepMap 100, Thermo Scientific), and then separated by a reversed-phase analytical column (Acclaim PepMap RSLC, Thermo Scientific). The peptides were accepted to NSI source followed by tandem mass spectrometry (MS/MS) in Q ExactiveTM Plus (Thermo) coupled online to the UPLC. In order to identify the proteins, we analyzed the resulting MS/MS data using Mascot search engine (v.2.3.0) and searched against Uniprot_rat database (32,983 sequences). We defined the proteins with iTRAQ ratios of >1.15 or <0.87 coupled with p <0.05 as differentially expressed proteins. Interaction network of differentially expressed proteins were made by STRING 11.0.
Morphological Techniques on Brain Slices
Rats were anesthetized with isoflurane and transcardially perfused with 100 milliliters normal saline and then perfused with 400 milliliters 4% paraformaldehyde solution. The brain was removed from the skull carefully. For Nissl staining, immunohistochemical staining and immunofluorescence staining, the brain was post-fixed in 4% paraformaldehyde solution for another 24 hours at 4 °C. In the dehydration, the sample was subjected to 20% and 30% sucrose gradient dehydration for twice until completely sunken. All brains were sliced into 30 μm coronal sections with a freezing microtom (Kryostat 1720, Leitz, Wetzler, Germany). The sections were consecutively collected and stored in 50% glycerinum in PBS at -20 °C.
Nissl Staining
The sections were washed with PBS for 2 minutes ´ 3 times, pasted on the slides and air-dried for 2 hours. Then they were immersed into Nissl dye liquor for several minutes according to the color changing, followed by decoloration in 75% alcohol, 95% alcohol twice for several minutes each. Subsequently, use the absolute ethyl alcohol for dehydration for 5 minutes ´ 3 times and the dimethylbenzene for transparency for 10 minutes twice. The sections were sealed and dried in fume hood. The images were obtained by an optical microscope (Nikon 90i, Tokyo, Japan).
Immunohistochemical and Immunofluorescence Staining
After being washed with PBS for 5 minutes ´ 3 times and treated by PBS containing 0.3% H2O2 and 0.5% Triton X-100 for 30 minutes at room temperature, the sections were pre-incubated with 3% normal goat serum and incubated in the primary antibodies (Table 1). 24 hours later, they were incubated for 1 hour with the secondary antibodies (Table 1) for 1 hour at 37°C after being washed with PBS. For immunohistochemical staining, immunoreaction was developed using Histostain TM-SP kits (ZSGB-Bio, Beijing, China) and visualized with diaminobenzidine (brown). The images were obtained by an optical microscope (Nikon 90i, Tokyo, Japan). For immunofluorescence stained sections, the images were observed using a laser scanning confocal microscope (Zeiss LSM 710, Germany).
Golgi Staining
After the brain was removed from the skull, golgi staining was developed using the FD Rapid GolgiStain kit (FD Neurotechnologies, Baltimore, MD) according to the manufacturer’s protocol. The samples were cut into horizontal sections of 100 μm thicknesses using a vibratome (Leica, Nussloch, Germany; S100, TPI) and mounted on the gelatin-coated slide. The sections were dehydrated in successive alcohol and transparency in xylene, and then the slide was sealed. The sections were observed and imaged by using an ordinary optical microscope (Nikon 90i, Tokyo, Japan). The number of dendritic spines on hippocampus pyramidal neurons was counted in Image-Pro Plus 6.0 software (Media Cybernetics, Inc. USA).
Western Blotting
The rats were anaesthetized with isoflurane and sacrificed. The hippocampi were quickly dissected out of brain and frozen at -80 °C. For the analysis of whole cell components, the sample of hippocampus was homogenized in cold buffer solution containing 10 mM Tris-HCl (pH 7.4), 50 mM NaCl, 50 mM NaF, 0.5 mM Na3VO4, 1 mM EDTA, 1 mM benzamidine, 1.0 mM phenylmethylsulfonyl fluoride (PMSF), 5 mg/ml leupeptin, 5 mg/ml aprotinin and 2 mg/ml pepstatin. Lysates were mixed with 4 × extracting buffer and protein concentrations were determined using a BCA protein assay kit (Rockford, IL, USA). All the sample solutions were stored at -80 °C for use. For Western blotting analysis of nuclear and cytoplasmic fractions[25], proteins were extracted with the kit from KeyGen Biotech (NanJing KeyGen Biotech Co.,Ltd.).
Before sample-loading, a final concentration of 10% β-mercaptoethanol and 0.05% bromophenol blue were added. The proteins were separated by 10% sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE) and probed with primary antibodies (Table 1). Secondary antibodies were anti-rabbit or anti-mouse IgG conjugated to [email protected] (800 CW; 1:10,000). The intensities of immunoblotting strips were automatically recognized by the Odyssey system (Li-Cor Bioscience, Lincoln, Nebraska, USA). All intensities of strips were normalized by the average intensity of DM1A. Then take the average value of Ctrl group as 1, and calculate the relative intensity of each strip.
Quantitative Real-time Polymerase Chain Reaction (qPCR)
Total RNA was extracted from hippocampal using TRIzol reagent (Invitrogen, Carlsbad, California, USA) according to the manufacturer’s protocol. RNA260/280 was measured spectrophotometrically for determining the concentration and purity. To synthesise cDNA from miRNA, we used M-MLV Reverse Transcriptase cDNA Synthesis Kit (Invitrogen, Carlsbad, California, USA) according to the supplier’s recommendations. The qPCR amplifcation was performed by CFX96 Real-Time PCR Detection System (Bio-Rad, Hercules, California, USA) and SYBR Green Premix Ex TaqTM (TaKaRa, Kyogo, Japan). The reaction conditions were as follows, an initial denaturation 3 minutes at 95 °C, followed by 45 cycles 10 seconds at 95 °C, 30 seconds at 60 °C, and extension 30 seconds at 72 °C. The primers for qPCR analysis were designed and synthesized. The data was quantified using the ΔΔCt-method.
Luciferase Assays for Identifying miR-target Interactions
Normal and mutated 3’-UTR sequences of 5-LO were subcloned into the psiCHECK-2 reporter plasmid (Qijing Biotechnology Co., Ltd., Wuhan, China) as previously described[26]. HEK293T cells were transfected with psiCHECK-2 plasmid containing the 3’-UTR and the overexpressing vector for a specific miRNA. 24 hours after transfection, cells were lysed and luciferase reporter activities were assayed as previously described[26].
Enzyme-linked Immuno Sorbent Assay (ELISA)
The hippocampal levels of IL-1b, TNF-α and leukotriene B4 (LTB4) were assayed by ELISA according to the protocols of ELISA kits (Elabscience Biotechnology Co., Ltd, Wuhan, China). A microplate reader (Biotek, Winooski, VT, USA) set to 450 nm was used to determine the optical density (OD) of value. A standard curve was created by plotting the mean OD value for each standard. The sample concentration was determined from the standard curve.
Predictions of microRNA Targeting
The miR-targeting predictions were performed by 3 different web-based algorithms, Targetscan software (http://www.targetscan.org), miRbase (http://www.mirbase.org/), and miRDB (http://www.mirdb.org/miRDB/).
Statistical Analysis
The data were analyzed using SPSS 12.0 (SPSS Inc., Chicago, Illinois, USA) and the statistical graphs were produced by GraphPad Prism (GraphPad Software, Inc., La Jolla, CA). Data were expressed as means ± SEM.. Differences among groups were tested with the one-way analysis of variance (ANOVA) procedure. The level of significance was set at p <0.05.