Mechanism of Cr(VI) reduction by an indigenous Rhizobium pusense CR02 isolated from chromite mining quarry water (CMQW) at Sukinda valley, India

doi:10.21203/rs.3.rs-1317477/v1

Download PDF

Research Article

Mechanism of Cr(VI) reduction by an indigenous Rhizobium pusense CR02 isolated from chromite mining quarry water (CMQW) at Sukinda valley, India

https://doi.org/10.21203/rs.3.rs-1317477/v1

This work is licensed under a CC BY 4.0 License

You are reading this latest preprint version

Toxicological assessment of CMQW generated due to chromite mining activities at Sukinda, valley has revealed high chromium contamination along with Zn and Fe. The present study focused on mechanism of chromate reduction by an indigenous multi-metal tolerant bacterium Rhizobium pusense CR02 isolated from CMQW. Isolated strain has shown resistance upto (520 mg/L) of Cr(VI) with IC50 value of 385.4 mg/L. The highest reduction rate 8.6×10^-2/h was recorded with 20 mg/L of initial concentration of Cr(VI). Extracellular (3.06±0.012 U/mL), intracellular (3.60±0.13 U/mL) and membrane (1.89±0.01 U/mL) associated chromate reductases were found to be involved for reduction. The extracellular polymeric substances (EPS) produced by the isolate also enhanced reduction activity of 46.32±1.69 mg/L after 72 h with initial concentration of 50 mg/L. FTIR analysis revealed the involvement of functional groups –OH, -CO and –NH for Cr(VI) biosorption whereas P=O, -CO-NH- and -COOH interacted with Cr(III). Zeta potential with less negative surface charge favored reduction of Cr(VI). Treatment of CMQW by bacterial isolate detoxified Cr(VI) minimizing chromosomal aberrations in root cells of Allium cepa L., suggesting the role of Rhizobium pusense CR02 as a promising bio-agent for Cr(VI) detoxification.

Hexavalent chromium

Bioreduction

Extracellular polymeric substances

Chromate reductase (ChR)

Zeta potential

Genotoxicity

Mining activity is considered as a ‘necessary evil’ because it highly beneficial for human life. Chromium is extensively utilized in metallurgy, thermonuclear weapon manufacturing, leather tanning, electroplating, paint industries, textile dyeing, steel, fertilizer, petroleum refining, and pigment production units (Allegretti et al. 2006; Ilias et al. 2011; Ataabadi et al. 2015; Sahoo et al. 2021). On the other hand its improper management adversely affects health, environment, and causes biodiversity loss (Jaishankar et al. 2014; Upadhyay et al. 2020). Chromium is found on rock and surface soil in trace quantities and with high concentration in surface water because of weathering and erosion. According to reports of Ministry of Mines, India (2017) about 0.14% of total geographical land (328 million hectares) has been utilized for mining activities. However, in India about 99% of the total chromite ores is produced at Sukinda in Odisha (Indian Bureau of Mines 2016) and an estimate of about 183 million tons of raw chromium deposits spread over 200 km² at Sukinda Valley (Das et al. 2013b). Sukinda chromite belt is considered as the 4th worst polluted region in the world because of mining activities which generates about 160 million tons of overburden and subsequently, releases about 11.73 tons of Cr(VI) to vicinity areas. According to many reports, pollutants discharged from mines, mostly contain Cr(VI) and disturb both surface as well as ground water sources. Most of the chromite mine query water (CMQW) are discharged to Damasala Nala which is severely polluted and channeled to the Brahmani river (Das and Singh 2011; Mishra and Sahu 2013; Upadhyay et al. 2020). Severe health complications in local people, loss of major biodiversity have been reported in the valley (Das and Singh 2011; Dhal et al. 2011; Mishra and Sahu 2013; Biswas et al. 2017; U.S. Geological Survey [USGS] 2018; Nayak et al. 2020; Upadhyay et al. 2020).

Mining activities at chromite deposited sites leads to the release of toxic chromium and other heavy metal pollutants. Among all toxic metals, chromium has great impact because of its wide scale application in industries for manufacturing and processing of products (Vendruscolo et al. 2016). Land deterioration, disorder in topographic index of soil, air quality, and disturbance of water table occur in the mining sites by erosion, leaching, weathering and acid drainage activities (Saviour 2012). Release of waste containing Cr(VI) leads to hazardous effects on human, plants, aquatic organisms and bio-magnification. Workers employed in highly contaminated chromium sites have shown the symptoms of vomiting, skin irritation/allergies, diarrhoea, bronchial asthma, nasal irritation, brain damage, premature death and impairing fetal development. Chromium toxicity also causes perforation in septum, ulcer in lungs, eardrum perforation, ulceration, kidney necrosis, and lung carcinoma (Gibb et al. 2000; WHO 2012; Ertani et al. 2017; WHO 2020). Cr(VI) has been proven to be mutagenic, carcinogenic and more toxic than Cr(III) (Kotas and Stasicka 2000; Jobby et al. 2018). Exposure of high concentration of chromium has been reported to cause alteration of enzyme specificity, oxidative damage, structural deformation in DNA [DNA-DNA crosslinks, DNA strand breaks, DNA-protein, Cr(III)-DNA adducts, and alkali-labile sites] in biological systems (Bruins et al. 2000). Further, metabolic alternation, oxidative damage, morphological disorganization, chlorosis, senescence, abrasion, premature leaf fall, decrease in seed germination index, photosynthetic impairment, stunted vegetative growth, and death of the plant have also been reported due to the chromium toxicity (Mohanty et al. 2009; Sahoo et al. 2020).

Hazardous nature of chromium toxicity is always an alarming concern around the globe. Wastewater and industrial effluent of heavy metal including chromium are treated through conventional methods such as precipitation, reverse osmosis, ion exchange, solvent extraction, electro-coagulation, electro-dialysis, membrane filter, cementation etc. But these techniques are expensive and generate huge sludge in large scale which brings secondary pollution (Kathiravan et al. 2010). Application of environment-friendly biological methods of treatment has many advantages over the conventional approaches. Microorganisms can biosorb, bioaccumulate and metabolize the pollutants by intracellular and extracellular enzymatic systems. Microbial based approach for detoxification of chromium contaminated water has attracted many researchers, because it not only removes the toxicants but also helps in physical removal by precipitation at near-neutral pH (Cheung and Gu 2003). Isolation, characterization and application of indigenous chromium reducing bacteria (CRB) from chromium polluted environments have played a key role in chromium bioremediation. The indigenous microbes have diverse resistance mechanisms and are thus acclimatized to the toxic environments (Dey and Paul 2012; Dey et al. 2014). However, biological reduction of Cr(VI) to Cr(III) by CRB is an ideal sustainable method for both economical and environment-friendly bioremediation.

Keeping in view of hazardous nature of chromium, present investigation focuses on the toxicological assessment and mitigation of CMQW by an indigenous novel CRB. The mechanism of chromium removal by novel bacteria strain using oxido-redox system has also been investigated. Further, reduced products were characterized by various methods to validate conversion of Cr(VI) to more stable and less toxic Cr(III) form. The Allium cepa L. root assay was used to test the genotoxic efficiency of collected CMQW and detoxification using indigenous potent CRB. The study would provide a detailed insight into mechanisms of chromium detoxification and application of isolated potent strain in ex-situ and in-situ bioremediation of Cr(VI) contaminated water.

Sample collection and CMQW characterization

CMQW sample was collected from sukinda chromite mines (21.061561N, 85.829338E) during pre-monsoon period (Fig. 1). Sampling was followed by estimation of Redox-potential and pH of the mine water. Physicochemical parameters such as dissolved oxygen (DO), total hardness (TH), total suspended solids (TSS), total dissolved solids (TDS), biological oxygen demand (BOD), alkalinity, sulfate and chemical oxygen demand (COD) were analyzed (APHA 2012). About 10 ml of sample was acid digested and filtered through a 0.22-micron membrane filter and analyzed by ICP-OES (Perkin Elmer Avio^TM 200) equipped with Syngistix^TM software for inductively coupled plasma optical emission spectrometry. Total carbon content and Cr(VI) in the collected sample was analyzed by TOC-analyzer (Shimadzu) and 1,5-diphenylcarbazide method (Zahoor and Rehman 2009) respectively.

Biochemical and molecular identification of potent chromate resistant bacteria

The spread plate method was employed for the enumeration of bacteria in diluted (10^-2dilution) CMQW on a nutrient agar plate at 37°C for 24 h (Sahoo et al. 2021). Colony morphology was observed followed by a screening of potent chromate resistant strain on 100 mg/L Cr(VI) amended Luria Bertani (LB) broth (g/L: tryptone 10.0, NaCl 10.0, yeast extract 5.0, pH 7.2) agar plates. Catalase, urease, citrate, oxidase, Methyl red, indole, amylase, triple sugar iron (TSI), Voges-Proskauer (VP), nitrate reduction, H₂S production, solubilization of tri-calcium phosphate, hydrolysis of chitin, starch, and gelatine were performed and findings compared with Bergey’s Manual (Holt et al. 1994). Multi-metal tolerance puissance of isolated strain was screened with a stepwise increasing concentration of As₂O₃, CoSO₄, CdSO₄, CuSO₄, HgCl₂, K₂Cr₂O₇, MoO₃, NiCl₂, Pb(NO₃)₂, and ZnSO₄at 35°C for 24 h of incubation. However, the minimum dose at which bacteria were able to grow was considered as the maximum tolerance limit (MTL) (Saranya et al. 2018). Biofilm capacity of the novel strain was characterized by the crystal violet staining method (Otoole and Kolter 1998).

Bacteria were grown in LB broth (0.25% glucose); without Cr(VI) and 100 mg/L Cr(VI) at 35°C for 24 h as control and treatment respectively. The culture was removed and rinsed with deionized water three times; adherent cells were stained with 0.5% crystal violet for 30 min and further rinsed with deionized water. Bacterial retained crystal violet was extracted with ethanol and acetone (80:20) for 15 min. Absorbance was recorded at 492 nm and classified according to the Stepanovic et al. (2007): non-biofilm producer (OD ≤ ODc), weak biofilm producer (OD > ODc, but ≤ 2 × ODc), moderate biofilm producer (OD > 2 × ODc, but ≤ 4 × ODc), and strong biofilm producer (OD > 4 × ODc). Here ‘ODc’ represents media without bacterial inoculants and ‘OD’ represents media with bacterial inoculants.

Twelve different antibiotics (Himedia) such as Penicillin-G (P-10 units), Chloramphenicol (C-30 mcg), Azithromycin (AZM-15 mcg), Streptomycin (S-10 mcg), Erythromycin (E-15 mcg), Tetracycline (TE-30 mcg), Amikacin (AK-30 mcg), Vancomycin (VA-30 mcg), Clindamycin (CD-2 mcg), Trimethoprim (TR-5 mcg), Ciprofloxacin (CIP-5 mcg), and Gentamycin (G-10 mcg) were used on nutrient agar plates for screening of antibiotic resistant strains by calculating the zone of inhibitions at 37°C after 24 h of incubation.

Genomic DNA was isolated from the potent chromate resistant strain-CR02 by using QIAamp DNA Mini Kit from Qiagen. The 16S rDNA was amplified with universal primer sets, forward primer E8f (5'-AGAGTTTGATCCTGGCTCAG-3'), and reverse primer 1541r (5'-AGGGAGGTGATCCANCCRCA-3') (Mahbub et al. 2017). Corresponding neighbour sequences (Based upon maximum similarity and zero E-value) were downloaded from the NCBI database and valid type strains sequences from the EzBioCloud database. A phylogenetic tree was constructed by aligning the sequences and bootstrapped neighbor-joining relationships (1000 replicates) with MEGA-X software (Tamura et al. 2013; Kumar et al. 2018; Sahoo et al. 2021).

MTT assay and DNA stability assessment

Effect of high concentration of Cr(VI) on growth and genomic content of bacteria was investigated through growth inhibition and DNA profiling study by 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide) tetrazolium (MTT) assay (Jena et al. 2012; Grela et al. 2015) and gel-based approaches respectively (Das et al. 2021). Strain was grown in LB broth with varying Cr(VI) concentrations (10, 20, 30, 40, 50, 60, 70, 80, 90, 100, 200, 300, 500, and 1000 mg/L) and bacterial culture without Cr(VI) was considered as control (Grela et al. 2015). Inoculants was seeded as per 0.5 McFarland standard in 96 well-plate for both control and treatment [Cr(VI) concentrations] followed by incubation at 35°C for 48 h. The incubated culture was mixed with 20 µL of 0.5 mg/mL of MTT in PBS (pH 7.4) followed by 2 h of incubation at 35°C. MTT gets converted to a purple insoluble formazan crystal in metabolically active cells. About100 µL of dimethyl sulfoxide (DMSO) was added to solubilise the formazan crystals and absorbance was taken at 570 nm using a micro-plate reader (CYTATION5 imaging reader, BioTek). The percentage cell inhibition and the IC50 value was calculated according to Jena et al. (2012). On the basis of IC50 result, DNA was isolated from bacterial biomass cultured with 50, 100, 300, 500, and 1000 mg/Lof Cr(VI) followed by estimation of DNA band intensity through Gel-Documentation system (Biorad).

CMQW detoxification potency of strain-CR02 in batch culture

Bacteria were grown in LB broth for 18 h at 35°C with constant shaking at 120 rpm and when the bacterial culture at OD₆₀₀ reaches 0.5, culture was drawn and centrifuged for 10 min at 8,000 × g. Further, collected bacterial pellet was (1.0 g of biomass) inoculated to 1000 mL of sterilized CMQW for 24 h. After 24 h of incubation residual Cr(VI), TCr, and removal efficiency were evaluated and expressed as mg/L. For residual Cr(VI) and TCr in CMQW after 24 h of incubation was analyzed by 1,5-diphenylcarbazide and ICP-OES method respectively. The percentage of Cr(VI) removal from CMQW was estimated according to Sahoo et al. (2021). Bacterial Cr(VI) removal puissance was assessed, both in LB broth (pH 7.5) having 2% (w/v) sucrose and without sucrose for 72 h at 35°C with continuous shaking for 120 rpm. In brief, LB media have different concentration of Cr(VI) (10, 20, 50, and 100 mg/L) without sucrose as LB10, LB20, LB50, and LB100 respectively. Similarly, LB medium having different concentration of Cr(VI) (10, 20, 50, and 100 mg/L) with (2%) sucrose coded as LBS10, LBS20, LBS50, and LBS100 respectively.

Extracellular polymeric substances (EPS) characterization and Cr(VI) removal assay

Biofloculant formation activity of isolated strain was evaluated according to Gomaa (2012). Bacterial culture was inoculated with fermentation media [(g/L): glucose, 2; KH₂PO₄, 5; peptone, 5 and yeast extract, 5 at pH 7.2] at 30°C for 72 h at 120 rpm (Subudhi et al. 2014). Different carbon sources like, fructose, glucose, maltose, sucrose, lactose was optimized for the flocculation activities. Similarly, flocculant activity of strain-CR02 was estimated in fermentation media along with 100 mg/L of chromium at 30°C for 72 h at 120 rpm. The bacterial suspension was centrifuged at 10,000 × g for 30 min, and collected supernatant was used for the flocculating activity. For estimation of flocculating activity, 0.5% of Kaolin clay suspension (in deionized water) was used; five hundred microlitres of supernatant (deionized water used as blank) was mixed with about 45 mL of kaolin suspension and 4.5 mL of CaCl₂ solution (1%). Subsequently, mixed content was vortexed for 5 min and kept for 5 min at 30°C without disturbing. Absorbance (OD₅₅₀) was recorded and flocculating activity was calculated as (Gomaa 2012; Ayangbenro et al. 2019):

Flocculating activity = (a–b)/a× 100

(Where ‘a’ and ‘b’ are the OD values of control and experimental sample respectively at 550 nm.)

EPS extraction was performed according to Bramhachari and Dubey 2006. About 5 mL of bacterial isolate (OD 0.5 at a wavelength of 600 nm) were grown on 100 mL of LB medium containing 100 mg/L Cr(VI) enriched with 2% (w/v) sucrose for 72 h at 35°C. A total of 10 mL sample was centrifuged at 10,000 × g for 30 min at 20°C. The resulting supernatant was boiled at 100°C for 15 min, cooled, and precipitated with 4% (w/v) trichloroacetic acid followed by centrifugation at 10,000 × g for 30 min at 4°C. The supernatant was further precipitated overnight at 4°C with two volumes of absolute ethanol followed by centrifugation at 10,000 × g for 30 min at 4°C heat drying at 100°C for 15 min. EPS dry weight was calculated and expressed in g/L. Protein estimation was done by taking Bovine Serum Albumin (BSA) as standard following the Bradford assay (Bradford 1976). Lipid content of isolated EPS was estimated by chloroform: methanol (2:1) extraction method. Phenol sulphuric acid assay was used for estimation of total carbohydrate contents for EPS according to Dubois et al. (1956). In brief, about 100 µL of EPS (1 mg/mL in 50 mM tris-HCl, pH 7.0) was added to 500 μL of 80 % (w/v) phenol solution followed by mixing with 2 mL of H₂SO₄ at 30°C for 10 min. Absorbance was recorded at 490 nm and sugar content was calculated from the standard glucose curve (Gupta et al. 2019). Cr(VI) removal efficiency of EPS was estimated at the interval of 1 h up to 6 h of incubation (Zahoor and Rehman 2009). Percentage of Cr(VI) removal was estimated according to Sahoo et al. (2021) as follows:

Removal (%) = (A-B)/ A × 100 [Here ‘A’ and ‘B’ represents initial and final residual Cr(VI) contents in sample respectively].

Chromate reductase genes and localization of chromate reductase enzymes

Both molecular and enzymatic approaches were employed for the validation of chromate reductase activities in the isolated potent strain-CR02. For validation of bacterial chromate reductase genes (ChR and ChrT) in strain-CR02, PCR-based screening was done with genomic DNA (Sahoo et al. 2021). PCR amplification of ChR and ChrT genes was carried out in thermal cycler (Veriti-96, Applied Biosystems, USA) by using primer sets of ChR (forward 5’TCACGCCGGAATATAACTAC3’, reverse 5’CGTACCCTGATCAATCACTT3’) (Patra et al. 2010) and ChrT (forward 5’ATCATGTCAGATACCTTGAAAGTGG3’, reverse 5’TGCTTTAACCCGCCGAATATA3’) (Zhou et al. 2017). Based on homology similarity of sequences, a phylogenetic tree was constructed by using MEGA-X with neighbor-joining method (Tamura et al. 2013; Sahoo et al. 2021).

Characterization of functional sites for chromate reductase in strain-CR02, cultured bacterial suspensions (LB broth for 24 h at 37°C, OD₆₀₀ = 0.6) were centrifuged at 14,000 × g for 15 min at 4°C, collected supernatant was passed through 0.22 µm filter as cell-free extracellular contents (CFECs). Collected bacterial pellets were washed three times and resuspended with 10 mL of 50 mM phosphate buffer (pH 7.0). Further, these cells were broken by ultrasonication at 35 W (Cole-Parmer, USA) for 20 cycles of 10 sec on with a gap of 10 sec off between each cycle in cold conditions. Bacterial lysate was centrifuged for 30 min at 15,000 × g at 4°C to remove unbroken cells followed by ultracentrifugation of collected supernatant at 90,000 × g for 1 h at 4°C. Subsequently, these supernatants were used as intracellular contents (ICs) and the pellet was dissolved in membrane solubilization buffer (150 mM potassium acetate, 30 mM HEPES, 10% (v/v) glycerol, 2% digitonin, pH 7.4 at 4°C) for 2 h at 4°C. Solubilized membrane contents were further centrifuged at 15,000 × g for 30 min at 4°C and collected supernatants were used as membrane components (MCs). Chromate reductase activity of CFECs, ICs, and MCs in strain-CR02 was evaluated according to Ontanon et al. (2018) with some modification. Protein concentrations in collected CFECs, ICs, and MCs were estimated by the Bradford method (Bradford 1976). For chromate reductase assay, a total volume of 3 mL reaction mixture contained different components of bacteria (CFEs, ICs, and MCs) (1 mg/mL of protein), Cr(VI) [10 mg/L], and 50 mM phosphate buffer (pH 7.0) along with 6.5 mg/L NADH, followed by incubation in agitation at 30°C for 60 min. Residual Cr(VI) was estimated at every 15 min by the 1,5-diphenylcarbazide method. For control [non-enzymatic Cr(VI) reduction] was performed as follows: reaction mixture containing 10 mg/L Cr(VI), 6.5 mg/L NADH along with 50 mM phosphate buffer with pre-heated (100°C for 5 min) CFECs, ICs, and MCs respectively. However, one unit (U) of Cr reductase activity was specified as the amount of enzyme that reduced 1 µM of Cr(VI) per min under the defined assay conditions. Specific activity for chromate reductase was defined as the unit activity per mg of protein (Ontanon et al. 2018).

Antioxidant Assay

Ten (10) millilitre of control and 100 mg/Lof Cr(VI) treated bacteria culture were centrifuged at 10,000 × g for 10 min at 4°C, pellet was resuspended with 1 mL of lysis buffer [2 mM MgCl₂, 0.1 mM EDTANa₂, 100 mM Tris–HCl (pH 8.0), 0.2 M NaCl, 1 % Triton X-100]. In the next phase sonication (Cole-Parmer, USA) at 35 kHz frequency rate with 10 s on and 10 s off for 20 cycles at 4°C was carried out and lysate was centrifuged for 15 min at 20,000 × g and 4°C (Zhang et al. 2013). Protein content in the crude extract was estimated by Bradford assay (Bradford 1976). Antioxidant enzymes such as catalase, peroxidase and superoxide dismutase were carried out to assess the mechanism of the isolated strain-CR02 against the toxic effect of Cr(VI). Peroxidase activity was measured according to the method of Chance and Maehly (1955). Similarly, catalase and SOD activity was measured by using standard methods of Aebi (1984) and Ewing and Janero (1995) respectively. All the detailed enzymatic assay protocols were followed as stated in Sahoo et al. (2021).

Morphology and surface interactions assessment

Bacterial cells [control, CMQW, and Cr(VI) treated] were fixed in 2% (w/v) para-formaldehyde buffered with 0.1 M sodium phosphate buffer saline (pH 7.0) at 4°C for 18 h. Cells were fixed with 1 % of osmium tetraoxide at 4°C for 2 h, washed and dehydrated with gradient ethanol-water solution (15 %, 30 %, 50 %, 70 %, and 90 % ethanol) for 2 min each. Further slides were kept for drying under a CO₂ atmosphere for 15 min and mounted with aluminium stubs. Mounted glass slides were coated with 90 Å thick gold palladium (VG Microtech, East Sussex, TN22, England) and observed at 5 kV with field emission scanning electron microscopy (Model-Zeiss EVO40). Biosorption of chromium by isolated strain was analyzed by an energy-dispersive X-ray spectrometer (EDAX, USA) at 5 kV (Sahoo et al. 2020).

The electrokinetics based on Zeta potential of bacterial cells in both control and Cr(VI) conditions were calculated according to Lage et al. (2012) to find out the changes in the surface charges of the bacterium as changes in surface charge play an important role in the interaction of different ions onto the cell wall. The Zeta potential of strain-CR02 in the presence and absence of Cr(VI) was measured using a Litesizer500 equipped with a universal dip cell omega cuvette (Mat. No. 155765). In brief, control bacterial cultures and culture with Cr(VI) 100 mg/L at 35°C for 48 h were harvested at 10,000 × g for 10 min followed by resuspended with PBS (pH 7.4) to minimize the reign of pH (Li et al. 2020).

Bacterial surface chemistry and involvement of different functional groups on the cell wall can be confirmed by Fourier Transform Infrared Spectroscopy (FTIR). In the present investigation, FTIR was used to identify the changes in functional groups of novel isolated strain and extracted EPS under different stress conditions. Approximately 5 mg of dried biomass and EPS were finely powdered with 50 mg of potassium bromide, powdered samples were pressed and KBr pellets were used for the IR study (Sahoo et al. 2020). The infrared spectra (% T) were recorded within a range of 400 to 4000 cm⁻¹by using a Spectrum RX I Perkin Elmer, FTIR Spectrometer (Thermo scientific).

Characterization of bacterial reduced products

Batch cultured bacterial sample was recovered from 100 mg/L Cr(VI) amended with 2% (w/v) sucrose in LB media after 72 h followed by three times washing with deionized water. Powdered biomass was subject to XRD and XPS analysis. XRD was done by using Rigaku Ultima-IV X-ray Diffractometer (Rigaku, Tokyo, Japan), having Cu Kα radiations (40 kV, 40 mA) with a scan rate of 8° and 2θ/min ranging from 20 to 80 degree in a continuous scan mode (Srivastava and Thakur 2012; Mishra et al. 2021). The surface chemistry of potent chromium resistant strain-CR02 was analyzed by XPS (XPS, PHI 5000 VersaProbe II, ULVAC-PHI Inc., USA) equipped with micro-focused (200 μm, 15 kV) and monochromatic Al-Kα X-Ray source (hν = 1486.6 eV). Both survey spectra scan (with an X-ray source power of 50W and pass energy of 187.85 eV) and narrow scans (high-resolution spectra of the major elements were recorded at 46.95 eV pass energy) results were recorded. PHI's Multipak software was used for processing XPS data and the C 1s peak at 284.8 eV binding energy was used as reference.

Sub-chronic toxicity efficacy on Allium cepa L.

Allium cepa L. (2n=16) bulbs were collected from the local market (morphologically similar and healthy bulbs were selected for this study). Dry roots, leaves were removed from onion bulbs followed by rinsed with sterilized water. These bulbs were allowed to germinate under distilled water for 48 h and nearly about 0.5 cm of grown root bulbs were selected. Autoclaved distilled water used as control, CMQW as a positive control, and detoxified CMQW by strain-CR02 for experimental purpose. For each treatment, five onion bulbs were taken and grown in 50 mL of solution each for 144 h at room temperature in dark conditions followed by daily replacement of solution. Each treatment was carried out in triplicate for statistical validation. Genotoxicity assay for each group, 5 numbers of roots (2-3 cm) was randomLy selected followed by fixation with Carnoy’s Solution (3 volume of ethanol: 1 volume of glacial acetic acid) and stored for 2 h at 4°C. After fixation, the root tips were transferred to 70% ethanol (preservation purpose) for mitotic aberration (MA) and chromosomal aberration (CA) study (Chauhan et al. 1999). In brief, root tips were hydrolyzed in 1M HCl at 60°C for 5 min, washed with distilled water and stained with 2% (w/v) acetocarmine solution for 3 min. Glass slide was prepared by putting slight pressure to make cells squash on the surface of slide and randomly examined under a light microscope at 400X. About 1000 numbers of cells were taken into consideration for scoring; occurrence of micronuclei, nuclear buds, bi-nuclei, and chromosomal aberrations in diving metaphase, anaphase, and telophase were examined. The mitotic index of respective treatments were calculated as percentage of cells undergoing mitotic stages (including prophase) per 1000 number of cells examined per onion bulb. However, chromosomal aberrations were calculated as a number of specific aberrations in 100 dividing cells (metaphase, anaphase, and telophase) per onion bulb. The percentage of mitotic index (MI), chromosomal abnormality index (CAI), nuclear abnormality index (NAI), and micronucleus index (MN) were calculated by following formulae (Maity et al. 2020).

MI (%) = (total no. of dividing cells/total no. of cells observed) × 100

CAI (%) = (total no. of cells with chromosomal abnormalities/total no. of dividing cells) × 100

NAI (%) = (total no. of cells with nuclear abnormalities/total no. of dividing cells) × 100

MN (%) = (total no. of cells with micronucleus/total no. of dividing cells) × 100

Statistical analysis

For all the analysis three replicates were carried out in triplicate and results were represented as mean ± standard deviation (SD) to validate the accuracy of the experiment. For the confirmation of statistically significant differences, data were evaluated using one-way analysis of variance (ANOVA) followed by the use of post-hoc tests for Tukey’s test (p≤0.05), using Origin Pro 8.5 software.

Characterization of CMQW

Collected mine water (CMQW) was physico-chemically characterized with pH (7.8 ± 0.1), redox-potential (42.2 ± 2.80 mV), TSS (23.33 ± 2.65), TDS (143.88 ± 7.87), TH (138.55 ± 8.14), DO (10.54 ± 1.93), alkalinity (44.22 ± 6.00), and sulfate (25.23 ± 4.62) mg/L respectively. However, COD, BOD, and TOC were determined as 57.26 ± 6.80, 0.9 ± 0.23, and 0.479 ± 0.054 mg/L respectively. Earlier study have reported that water samples from Sukinda valley contain around 3.31 mg/L of TCr and 2.81 mg/L of Cr(VI) with a pH of 7.75 (Prabhakaran et al. 2019). CMQW comprises of different heavy metal contents (mg/L): As (0.068), Cd (0.000), Co (0.116), Cr (2.988), Cu (0.072), Fe (0.516), Li (0.072), Mn (0.056), Ni (0.012), Pb (0.000), and Zn (8.392). ICP-OES and diphenylcarbazide method revealed the amount of total chromium (TCr), Cr(VI) and Cr(III) as 2.988, 1.8, and 1.188 mg/L respectively. Das et al. (2013a) have reported on both mine quarry water and groundwater of Sukinda region with high concentration of different metals (Cr > Fe > Zn > Ni > Co > Mn) whereas groundwater was only contaminated with iron. TCr and Cr(VI) in Sukinda mine water was quite high and ranged from 0.74-3.12 mg/L and 0.347-2.15 mg/L respectively (Das et al. 2013a). But recent studies have concluded both surface water and groundwater have been contaminated with chromium along with other metals (Naz et al. 2016; Equeenuddin and Pattnaik 2020). Among Cr(VI) and Cr(III), former is predominant in alkaline and oxidizing environments (Fendorf 1995), which is very much similar to findings of our investigation. Chromium species in the mine water was mostly dominated by Cr(VI) and its pH was found to be alkaline whereas Cr(III) was dominated in both groundwater and surface water. Chromium speciation in the environment is influenced by both Eh and the pH of water (Henderson 1994).

Biochemical and molecular identification of potent chromate resistant bacteria

A total of three morphologically different Cr(VI) tolerant bacterial strains were screened from CMQW on LB agar plate supplied with 100 mg/L of Cr(VI) and considered chromate resistant bacteria (CRB). Among these strains, CR02 has shown the highest tolerance ability at 520 mg/L of Cr(VI) stress. The optimum condition with pH (7.5), temperature (35°C) was found to be the ideal environment for the growth of CR02 strain. Strain CR02 was characterized with mesophilic, white-colored, irregular, undulate margin, raised elevation, rod-shaped, and gram-negative bacterium. The strain has shown negative towards oxidase, amylase, H₂S production, voges-proskauer (VP), phosphate solubilization, starch hydrolysis, gelatinase activity, and citrate utilization as carbon source; whereas shows positive result towards methyl red, urease, catalase, indole, nitrate reductase, cellulase, chitinase, protease, and fermentation of dextrose. Identified characteristic features of strain CR02 were compared with Bergey’s manual of determinative bacteriology and this bacterium is contingently identified to be a member of genera Rhizobium.

The MTL of strain-CR02 towards different metals was found to be (mg/L): As (260), Cd (100), Co (220), Cr (520), Hg (30), Mo (650), Ni (180), Pb (380), Zn (1250) respectively. It was evident that the isolated strain has the lowest tolerance for HgCl₂ and maximum for ZnSO₄. Isolated strain-CR02 might have developed the resistance and detoxification mechanism of Cr(VI) through adsorption, uptake, and biotransformation mechanisms to with stand the toxic environment (Das et al. 2021). However, strain CR02 was found to be sensitive towards Hg (30 mg/L) and Cd (100 mg/L). Industrial effluents and mine drainage contain varying types of contaminants including heavy metals (Ontanon et al. 2018; Sahoo et al. 2020; Sahoo et al. 2021). In our previous report, a multi-metal tolerant strain Enterobacter sp. AMD01 isolated from an iron-ore mining site, could efficiently able to remove about 95% of toxic metals from acid mine drainage (Sahoo et al. 2020). Thus, for proper biological treatment and management of wastewater, there must be the search for tolerant microorganisms and their resistance to toxic environments. It could also be evident that strain-CR02 might maintain the physiological adaptation mechanisms such as biosorption, accumulation and transformation to overcome the metal toxicity along with its reduction. Ontanon et al. (2018) have reported multi-metals resistant strain Bacillus sp. SFC500-1E form tannery sediments showed bioremediation efficiency in removing Cr(VI). Tan et al. (2020) have also reported chromium reducing bacteria Bacillus sp. CRB-B1 isolated from sewage treatment plant with 420 mg/L of chromium MIC value. Further, isolated strain CR02 has shown resistance to antibiotics clindamycin and trimethoprim. It was observed that strain-CR02 has 8.04, 7.07, 3.80, 11.34, 5.31, 3.46, 7.54, 4.15, 18.09, and 4.15 mm² zones of inhibition against penicillin-G, chloramphenicol, streptomycin, tetracycline, amikacin, vancomycin, azithromycin, erythromycin, ciprofloxacin, and gentamycin respectively. Previous studies has also documented that certain chromate resistant bacteria stains have resistance capacity against most of the tested antibiotics (Mishra et al. 2012; Khusro et al. 2014).

Bio-film producing efficiency of strain-CR02 was found to be moderate under the control condition without chromium, while strong biofilm formation activity was observed under 100 mg L^-1 Cr(VI) condition. The study suggested that strain-CR02 has potential for development for biofilm in response to Cr(VI) stress. Pan et al. (2014) have reported on bioreduction of Cr(VI) to Cr(III) which was subsequently immobilized by extra cellular polymeric substances within the biofilm of Bacillus Subtilis. Kang et al. (2005) have also reported that EPS of biofilm has greater absorption of Cd²⁺ and Pb²⁺ in water environment facilitating the efficient microbial remediation processes. Microbes produce different types of polysaccharides, which play an important role in the development of biofilm and help for biosorption of metals, flocculation, adherent to the surface, and mediator for the cell to cell interaction in the toxic environment (Gupta et al. 2015; Schmid and Sieber 2015). Intensive studies for bacterial biofilm have also been reported for its wide-scale application in biotechnology, wastewater treatment, human infections, etc. (Jachlewski et al. 2015).

Based on sequence alignment of query 16S rDNA gene sequence with available sequences in NCBI databank, phylogenetic tree analysis was constructed. The isolated strain-CR02 was confirmed as Rhizobium pusense (Agrobacterium pusense) with 98% of sequence similarity (Fig. 2). Sequenced 16S rDNA gene has been submitted at NCBI-GenBank database and detailed information is available in the GenBank with accession number MZ617264. Very little information on bioremediation of Cr(VI) by Rhizobium sp. is available in the database. Both biochemical and physiological findings confirm the survivability of bacterium in toxic environment with a high concentration of different heavy metals. This study might ascertain our knowledge of the ecological adaptations of the strain-CR02 in a toxic chromite mine water environment.

Growth inhibition and DNA stability profiling

Survivability of the selected strain was noticed to be decreased with increasing concentration of Cr(VI) as evident from CFU/mL value (data not shown), that with an increase in Cr(VI) concentration the survivability of the bacterium is getting decreased. The IC50 value for the bacterium CR02 towards Cr(VI) was found to be very high (358.4 mg/L) (Fig. S1a). Further, the genotoxicity of varying concentration of Cr(VI) on bacterial DNA profile was evaluated against the control. Comparative investigation of the genomic content (both concentration and band intensity) of bacteria was found to be reduced with increasing Cr(VI) concentration (fig. S1b). Current findings were found to be similar to the previous reports where a high concentration of Cr(VI) leads to damage of DNA by oxidation of guanine residue (Kasprzak 2002), chromosomal aberrations, mutation, the constraint of polymerase activity and other genotoxic effects (Tsou et al. 1997; Das et al. 2021).

Removal of Cr(VI) and detoxification potency in batch culture

Reduction of TCr, Cr(VI), and other toxic metals in CMQW after 24 h was calculated by taking about one gram of cultured bacterial pellet under the defined assay conditions. Removal efficiency for toxic metals in CMQW by strain Rhizobium pusense CR02 has been shown in Table 1. Concentration of removed Zn, TCr, and Cr(VI) was evaluated as 6.55, 2.34, and 1.36 mg/L respectively after 24 h of incubation with Rhizobium pusense CR02 biomass (1.0 g). It was evident that Rhizobium pusense CR02 had high adsorption efficiency towards different metal ions. Rhizobium pusense CR02 has shown the highest Cr(VI) removal efficiency (46.32 ± 1.69^h mg/L) from the aqueous solution with 50 mg/L of chromium, 2% (w/v) sucrose after 72 h of incubation (Fig. 3a, Table 2) in comparison to LB without sucrose having 100 mg/L of Cr(VI) (26.91 ± 1.30^e mg/L). Tan et al. (2020) have reported Bacillus sp. CRB-B1 with maximum Cr(VI) reduction efficiency of 97.04% at 150 mg/L of Cr(VI) at optimum assay conditions (35°C, 30 h, and 150 rpm). The present investigation suggested that Cr(VI) reduction efficiency of Rhizobium pusense CR02 has increased Cr(VI) reduction efficiency in LB sucrose (2%) medium.

Table 1

Elemental analysis of CMQW and reduction of metals after 24 h batch culture treatment
Elements	Initial metal content in CMQW (mg/L)	Total residual metal content after 24 h batch culture (mg/L)	Removal of metals after 24 h batch culture (mg/L)	Metal reduction after 24 h batch culture (%)
As	0.068	0.013	0.055	80.88
Cd	Nil	Nil	-	-
Co	0.116	0.022	0.094	81.03
Cr	2.988 [TCr] 1.80 [Cr(VI)]	0.642 [TCr] 0.432 [Cr(VI)]	2.346 1.368	78.51 [TCr] 76.0 [Cr(VI)]
Cu	0.072	0.013	0.059	58.33
Fe	0.516	0.112	0.404	78.29
Li	0.072	0.011	0.061	84.72
Mn	0.056	0.007	0.049	87.5
Ni	0.012	Nil	0.012	100
Pb	Nil	Nil	-	-
Zn	8.392	1.837	6.555	78.11

Table 2

Cr(VI) removal efficiency of *Rhizobium pusense* CR02 under the assay condition
Incubation Period (h)	LB media with Cr(VI) (mg/L)				LB + Sucrose (2%) with Cr(VI) (mg/L)
Incubation Period (h)	LB10	LB20	LB50	LB100	LBS10	LBS20	LBS50	LBS100
12	1.31 ± 0.32^bh	1.38 ± 0.35^ch	1.64 ± 0.25^dh	0.66 ± 0.14^e	5.67 ± 0.60^a	6.59 ± 0.28^f	5.79± 0.37^a	3.24 ± 0.30^g
24	2.78 ± 0.38^bi	2.14 ± 0.19^ci	5.11 ± 0.30^dj	5.06 ± 0.30^ej	7.46 ± 0.51^f	9.01 ± 0.63^g	13.10 ± 1.83^a	11.32 ± 0.87^h
36	4.88 ± 0.36^bi	5.31 ± 0.31^ci	7.42 ± 0.32^d	8.58 ± 0.35^ej	8.90 ± 0.36^fj	17.12 ± 0.88^g	23.26 ± 1.24^a	16.14 ± 0.70^h
48	7.51± 0.36^bk	7.43 ± 0.31^ck	10.98 ± 0.55^dij	11.49 ±1.84^ej	9.36 ± 0.26^fj	18.86 ± 0.85^g	31.28 ± 2.17^a	23.31 ± 0.91^h
60	9.04 ± 0.21^bi	8.57 ± 0.41^ci	17.73 ± 0.99^d	22.52 ± 1.25^e	9.87 ± 0.22^fi	19.58 ± 0.40^g	39.31 ± 1.80^h	27.34 ± 1.89^a
72	9.63 ± 0.34^f	12.18 ± 0.82^c	21.42 ± 1.51^di	26.91 ± 1.30^e	9.96 ± 0.09^f	19.92 ± 0.12^gi	46.32 ± 1.69^h	34.44 ± 2.05^a
Cr(VI) reduction data at different concentrations were represents as mean ± SD (n=9), followed by Tukey’s test. Different letters as superscripts of respective incubation period denote significant difference between the means of treatments and same superscripts denotes means difference is not significant at p < 0.05.

The kinetics of Cr(VI) reduction by Rhizobium pusense CR02 in the aqueous solution at different initial Cr(VI) concentrations against time was studied by exponential decay equation (1) (Camargo et al. 2003; Das et al. 2014) and it was fitted well (Fig. 3b) with the linearized form of the exponential rate of equation (3).

y = a · e^-kt(1)

(2)

Linearization of equation (2) form becomes:

(3)

[Here ‘a’ is constant, is the Cr(VI) reduction fraction at a time 't', 'C’ is the concentration of Cr(VI) at a time 't', 'C_o' is the initial (original) Cr(VI) concentration and ‘K’ is considered as the rate constant]

Kinetic study result for time course Cr(VI) reduction data fitted well for LB10, LB20, LB50, LB100 (R² ≥ 0.93, 0.93, 0.95, 0.94 respectively) and LBS10, LBS20, LBS50, LBS100 (R² ≥ 0.96, 0.96, 0.92, 0.99 respectively) conditions to the linearized form of exponential rate of equation (3) [Fig. 3b(i), 3b(ii)]. It was evaluated that highest Cr(VI) reduction rate constant for LB10 [5.3×10^-2/ h at 10 mg/L Cr(VI)] and lowest for LB100 [5.0×10^-3/h at 100 mg/L Cr(VI)] in LB media conditions. Similarly, highest Cr(VI) reduction rate constant for LBS20 [8.6×10^-2/h at 20 mg/L Cr(VI)] and lowest for LBS100 [3.0×10^-3/h at 100 mg/L Cr(VI)] under LBS media conditions. The above findings show the highest reduction of Cr(VI) under the lowest Cr(VI) concentration of 20 mg/L and lowest at 100 mg/L with defined assay conditions. LB100 has also shown the highest rate constant [5.0×10^-3/h at 100 mg/L Cr(VI)] than LBS100 [3.0×10^-3/h at 100 mg/L Cr(VI)]. This might be due to the formation of biofilm under LBS conditions and increase in adsorption of Cr(VI) onto cell surface of Rhizobium pusense CR02 producing strong biofilm in response to Cr(VI) which may lead to lower reduction rate. Although the linearized form of equation fitted well and follow the pseudo-first-order kinetics but increase in Cr(VI) concentration decreases the rate constant. The study suggests that the disordered physiological state of the bacteria as Cr(VI) concentration increases in the solution. Das et al. (2014) have also reported the rate constant values for Cr(VI) reduction at 10-100 mg/L with Bacillus amyloliquefaciens CSB-9 isolated from chromite mine soil of Sukinda, India, have been reported to be the highest (2.8×10^-2/h) at 10 mg/L of Cr(VI) and lowest (0.44×10^-3/h) at 100 mg/L. A similar finding was also reported on a moderately halophilic bacterium Halomonas smyrnensis KS802 which shows the highest Cr(VI) reduction rate at low initial Cr(VI) concentration and lowest rate constant at higher initial Cr(VI) concentration (Biswas et al. 2018).

EPS formation and Cr(VI) reduction activity

Bioflocculants are considered biopolymers, basically produced by bacteria during the growth period and these biodegradable flocs are very efficacious towards the removal of metals and suspended particles from solution (Aljuboori et al. 2013). It was evident that bioflocculant production is greatly influenced by different nutrient parameters of media; Ayangbenro et al. (2019) have reported two bacterial isolates (Pantoea sp. and Pseudomonas koreensis) from mining sites with 71.3% and 56% of flocculating activity as carbon sources for glucose and sucrose respectively. In this present study, it was observed that Rhizobium pusense CR02 has the least flocculating activity when lactose is used as a carbon source and maximum with sucrose (data not shown). Different workers have reported sucrose as the commendatory carbon source for bioflocculant production in bacteria (Subudhi et al. 2016; Ayangbenro et al. 2019) which is very much similar to Rhizobium pusense CR02 in this study. Further, the flocculating activity of Rhizobium pusense CR02 under control and 100 mg/L of Cr(VI) condition was found to be 78.29 ± 2.78 and 97.06 ± 2.20 respectively. The current report on Rhizobium pusense CR02, has shown the highest flocculent activity under Cr(VI) condition and confirms sinew towards metal removal. Previous study has revealed the role of bioflocculant from strain Pantoea sp. having removal efficiency (%) of 80.5%, 52.5%, 51.2% for Pb, Cr, and Cd from wastewater respectively (Ayangbenro et al. 2019).

Further, extracted EPS from Rhizobium pusense CR02 under Cr(VI) condition was found to be maximum (8.906 ± 0.28 g/L) as compared to control condition (2.370 ± 0.09 g/L). Batool et al. (2015) have also reported a high concentration of total exopolysaccharides (mg/g of fresh weight) production under chromium conditions in Ochrobactrum intermedium Rb-2 as similar to our findings in the present study. Extracted EPS from Rhizobium pusense CR02 comprised of 22.62% (w/w), 46.32% (w/w), and 2.16% (w/w) of protein, carbohydrate, and lipids (dry weight) under control conditions respectively. However, EPS extracted from under Cr(VI) treated bacterial culture was noticed to be with higher content of protein (38.74% w/w), carbohydrate (66.12% w/w), and lipids (5.80% w/w) of dry weight. The amount of secreted carbohydrates under the Cr(VI) treated condition has also been found to be maximum in comparison to the control condition (Mungasavalli et al. 2007). Cr(VI) removal (mg/L) efficiency of extracted EPS was found as, 2.53 ± 0.09, 3.35 ± 0.05, 4.55 ± 0.05, and 8.0 ± 0.1 after 1 h, 2 h, 4 h, and 6 h of incubation respectively (Fig. 4). Structure and chemical composition of EPS plays an important role in removal of metals and flocculation activity for wide-scale application (Gupta et al. 2021). Sheng et al. (2005) have reported EPS with high number of amino groups might have enhanced binding and degradation efficiencies for different pollutants. Thus, from the above findings, this could be concluded that increased content of major cell wall constituents such as protein and carbohydrate are the attributes to interaction of chromate ions onto the bacteria surface facilitating detoxification of Cr (VI).

Localization of chromate reductase enzymes and Cr(VI) reduction mechanism

Present investigation revealed the presence of about 268 bp long putative chromate reductase gene R (ChR) in Rhizobium pusense CR02 and absence of chromate reductase gene T (ChrT). A phylogenetic tree showed that the gene ChR of strain-CR02 has a close relationship with chromate reductase of Rhizobium sp. BK251. Identified ChR sequence was submitted to NCBI (GenBank) with the accession number (OL616125). Presence of ChrR gene in Pseudomonas aeruginosa (Aguilar-Barajas et al. 2008), Staphylococcus simulans (Kalsoom et al. 2021), Serratia sp. GP01 (Sahoo et al. 2021) have been reported to have significant role in chromate resistance and reduction. Presence of chromate reductase gene (ChR) in Rhizobium pusense CR02 might have paramount contribution for its adaptation to extremely toxic environments and the reduction of Cr(VI) as well.

In this study, the chromate reductase activity of the crude extracts of CFECs, ICs, and MCs was recorded as 3.06 ± 0.012, 3.60 ± 0.13, and 1.89 ± 0.01 U/mL of protein, respectively (Fig. 5c). Strain Rhizobium pusense CR02 revealed efficient Cr(VI) reduction activity for both extracellular and cytosolic soluble reductase enzymes; and furthermore, it reflects the involvement of membrane proteins in Cr(VI) reduction process. Most of the bacterial chromate reductase was also reported from both cytosolic and membrane bounded fractions of cell, however few reports were also described extracellular chromate reductase activity (Mishra et al. 2021). Li et al. (2016) have reported high Cr(VI) reduction enzyme activity of 6.60 U/mL and 6.78 U/mL in cell free extract (CFE) and periplasmic content of Pseudoalteromonas sp. respectively. Results of Cr(VI) reduction efficiency (%) for cell free extracted crudes (CFECs), intracellular contents (ICs), and membrane contents (MCs) of Rhizobium pusense CR02 was found to be 74.8 ± 0.89%, 84.4 ± 0.56%, and 49.6 ± 0.62% respectively after 60 min of incubation under the defined assay conditions (Fig. 5b). Though, all the three localized components played important role in the Cr (VI) reduction, ICs have shown the highest reduction activity and lowest with MCs. From the above findings and floc formation activities as discussed earlier, the CFECs might be involved in both the adsorption and Cr(VI) reduction process. This could be concluded form the above findings, chromate reductase activity of strain Rhizobium pusense CR02 is associated with intracellular, extracellular and membrane components.

Antioxidant Assay

The total protein content of the bacterial crude extract was estimated as 6.8 mg/mL. Increased activity of SOD (47.14 U/mL), catalase (32.15 U/mL), and peroxidase (58.49 U/mL) in Rhizobium pusense CR02 were noticed in response to 100 mg/L of Cr(VI). Ilias et al. (2011) have reported metal-induced oxidative stress enhanced the production and accumulation of free radicals, leading to increased detoxifying enzyme concentration in the living system. The expression of protective enzymes (SOD, catalase and peroxidase) under normal conditions were found to be low and thought to be increased due to stress conditions to counter the reactive oxygen species (Sahoo et al. 2021). Though, Lenartova et al. (1998) have reported induction of SOD activity as the first line of defense against the generation of ROS, peroxidase-mediated reaction of oxidative polymerization helps in strengthening cell wall formation in repose to metal induced stress (Cosgrove 1997).

Antioxidant Assay

The result of the FESEM-EDX micrograph, under control condition (without treatment) revealed the uniform distribution of rod-shaped, elongated cells with smooth and regular surface characteristics and absence of Cr peak [Fig. 6a(i)]. However, bacterial cells under both Cr(VI) and CMQW conditions have shown distinct changes in morphology and distribution. Compactly arranged bacterial cells having more porous structures, roughness in surface texture, disordered cell size with globular appearance were found in response to CMQW [Fig. 6a(ii)]. Similarly, Cr(VI) treated bacteria cells showed the morphological changes, cell surface characteristics, and distribution pattern of strain-CR02 were observed. EDX-analysis confirms the disintegration and bio-adsorption of Cr(VI) onto the bacterial cell surface [Fig. 6a(iii)] in Cr(VI) aqueous condition. Changes in cell surface morphology (size, shape, roughness, porous structure, and swelling) of different bacteria like Bacillus subtilis, Bacillus cereus IST105, Escherichia coli, and Serratia sp. GP01 with response to Cr(VI) toxicity has been reported by different groups of authors. Bacteria might have developed the adaptation system to arrange themselves in groups and secretion of EPS to reduce the exposure and controlled intake of toxicants (Schembri et al. 2003; Naik et al. 2012; Samuel et al. 2013; Sahoo et al. 2021). Das et al. (2014) have reported the changes in cell morphology with coagulated, porous structure of cell surface, and roughness and immobilization of Cr(III) species on the Bacillus amyloliquefaciens cell surface in Cr(VI) treated conditions as analyzed with SEM-EDX. Both FESEM-EDX and reductase assay clearly suggested the high removal potency of Rhizobium pusense CR02.

The electrokinetics study of bacterial cell surface under control and 100 mg/L of Cr(VI) treated condition was assessed through zeta potential analysis at pH 7.4. The Zeta potential values indicated that the surface charge of Rhizobium pusense CR02 differs both in control (-17.0 ± 0.3 mV) and Cr(VI) treated conditions (-9.5 ± 1.9 mV) (Fig. 6b). It was observed that zeta potential was found to be less negative with subsequent interaction with Cr(VI) ion as compared to the control [Fig. 7b(i), 7b(ii)]. The less negative value of bacterial surface charge under Cr(VI) treated condition after 48 h of incubation facilitated adsorption followed by reduction of Cr(VI) to Cr(III). Binding of positively charged Cr(III) ions onto the bacterial surface leads to less negative surface charge in comparison to control. Previous studies have also reported on shifting of bacterial surface charge towards less negative in Corynebacterium paurometabolum, Sphingopyxis macrogoltabida SUK2c with increasing Cr(VI) concentration (Prabhakaran and Subramanian 2017; Prabhakaran et al. 2019). Li et al. (2020) have also reported the bioreduction of Cr(VI) by Bacillus subtilis and adsorption of positively charged Cr(III) ions, shifting zeta potential values towards less negative in comparison to control.

FTIR analyses of untreated bacteria, Cr(VI) treated bacteria, extracted EPS from control, and Cr(VI) treated bacteria have revealed the pattern of functional groups involved for Cr(VI) binding mechanistic in Rhizobium pusense CR02 (Fig. 6c). The distribution of reduced Cr(III) ions mainly depends upon the media composition and type of strain used for the reduction of Cr(VI) study (Mishra et al. 2012; Das et al. 2021). There is the possibility of the presence of organic acids and amino acids in the growth medium, which might compete with bacteria for coordination with Cr(III). Thus, IR spectra of the bacterial cell and extracted EPS from both control and Cr(VI) conditions could confirm the involvement of different functional groups for binding of reduced Cr(III) (Mishra et al. 2012; Sahoo et al. 2020; Das et al. 2021). It was observed that the stretch of the hydroxyl group shifted from the range 3710.42 cm^-1 (bacterial cells under control condition) to 3724.26 cm^-1 (bacterial cells under Cr treated condition); also there was the shift from 3678 cm^-1 (EPS from control condition) to 3679.30 cm^-1 (EPS from Cr treated condition). Further, some of the common banding patterns have been observed in the range of 3841-3723 cm^-1 of both Cr treated EPS and bacterial cells, indicating the interaction of Cr ions to both EPS and bacterial cells as well. Band stretching at 3300-3000 cm^-1 were corresponds to the –OH and –NH functional groups for glucose, hydroxyl, and proteins (Mary Mangaiyarkarasi et al. 2011; Das et al. 2021). The characteristic band stretching at 3249 cm^-1 and 3293 cm^-1 for EPS and control bacterial growth conditions indicates the presence of hydroxyl and proteins functional groups whereas the shift in the banding towards 3239 cm^-1 and 3282 cm^-1 under Cr(VI) treated conditions for both extracted EPS and bacterial biomass confirm the interaction of Cr-ions with protein and hydroxyl groups. The presence of a visible peak at 1713-1715 cm^-1 is the –CO bond of lipid group of EPS and the shift might be due to the Cr ions interaction to EPS. Further –NH bending of primary and secondary amide at 1600-1550 cm^-1 rage confirms the involvement of peptide bond of protein and the minor shift among these peak ranges and intensity compared to control is due to the interaction of Cr ions (Das et al. 2021). Spectra range between 1070-1080 cm^-1 corresponds to stretching vibration of –CO bond of polysaccharide which is found only in bacterial cells. However, there was a shift of spectral range 1081.31 cm^-1 of bacterial cells (control condition) to 1076.15 cm^-1 under Cr treated bacterial cells. Appearance of some low-intensity peak in Cr(VI) treated bacterial cells and EPS between 750-600 cm^-1 represents the involvement of Cr=O vibration of reduced Cr-species as shown in Fig. 6c (Mishra et al. 2012; Biswas et al. 2018; Das et al. 2021). The broadening of the absorption peak at 618 cm^-1 in all the groups, indicating the presence of polysaccharides on the cell surface and EPS which might be involved for Cr adsorption on Rhizobium pusense CR02 (Gupta et al. 2015). The presence of typical band stretching of 1116, 1643, 1396 and around 2926 cm^-1 indicates the existence of phosphoric acid (P=O or P-O), amide (-CO-NH-), carboxyl (-COOH) and hydroxyl (-OH) of extracted EPS (Zhu et al. 2019) and the minor spectral shift, decrease in intensity among these vibrations of Cr(VI) treated EPS shows the interaction of reduced Cr(III) ions with EPS. The phenomenon of adsorption of Cr ions onto the bacterial cell surface and EPS might be occurring due to modification of functional groups in response to chromium. Results of the IR study support the processes like chromium reduction, enzymatic and EPS-based Cr(VI) reduction, FESEM-EDX, zeta potential characteristics of Rhizobium pusense CR02. But the significantly reduced Cr(III) end product might have the chance of getting reoxidized to Cr(VI) (Zhu et al. 2019) hence, further investigation was focused on the characterization of bacterial reduced products.

Characterization of bacterial reduced products

The XRD diffractograms of both Cr(VI) treated and un-treated bacterial cells have shown (Fig. 7a) different peak values at 2θ (degree). Cr(VI) treated bacterial biomass have shown peak values at 2θ (degree) of 7.04, 27.45, 31.77, 45.50, 56.57, 63.34, and 75.33; with a high-intensity peak at 31.77. Mishra et al. (2021) have also reported some similar findings at 2θ (degree) value of 25.77, 27.22, 31.65, 45.27, and 38.20 in Microbacterium paraoxydans. The present investigation suggests the presence of possible Cr(III) reduced products in the form of different chromium oxides on the bacterial cell surface (Srivastava and Thakur 2012).

The XPS spectra of Cr(VI)-treated bacterial cells revealed a convoluted peak in the chromium zones (Fig. 7b). The binding energy at 577.52, and 587.25 eV corresponding to Cr2p_3/2 and Cr2p_1/2 orbitals were assigned for Cr(III) forms that is Cr(OH)₃ and organic complexes (Cr₂O₃) respectively (Park et al. 2008; Jin et al. 2016; Tan et al. 2020). Similarly, the optimum fitting peak at a binding energy of 581.82 eV is attributed to Cr2p_3/2 orbital. However, the higher binding energy of 580-580.5 eV and 589.0-590.0 eV was characterized as CrO₃, since Cr(VI) draws electrons very strongly than Cr(III) (Park et al. 2008). Chen et al. (2018) have reported the binding energy peak at 588.9 eV and 579.9 eV for the orbitals of Cr2p_1/2 and Cr2p_3/2 respectively. Observed binding energy in the current findings probably is attributed for Cr-oxides, Cr-hydroxides; indicating the strong evidence for the reduction of Cr(VI) to a stable product of Cr(III) by Rhizobium pusense CR02. Many workers have reported the assigned eV values for Cr2p_3/2 orbitals at 577.2-576.5 eV as Cr(III) compounds (Cr₂O₃), whereas Cr(VI) forms are characterized by higher eV values at 578.1 or 579.2 for K₂Cr₂O₇ (Liu et al. 2015; Jin et al. 2016; Mishra et al. 2021). FESEM-EDX, zeta potential, FTIR and other enzymatic studies confirmed the binding of Cr(VI) ions onto the cell surface possibly through EPS production facilitating the sequestration of Cr(VI). Further, XPS study confirmed the mechanistic of adsorption in conjugation with the Cr(VI) reduction by Rhizobium pusense CR02. A detailed graphical representation of Cr(VI) resistance and reduction mechanism in Rhizobium pusense CR02 was depicted in Fig. S3.

Sub-chronic assay

The toxicity of CMQW and detoxified CMQW by Rhizobium pusense CR02 on onion root was assessed through chromosomal aberration. Root morphology and genotoxicity results supported the findings of bioremediation of CMQW by Rhizobium pusense CR02 after 72 h (Fig. 8, Fig. S4). Although morphological assessment of onion root length under detoxified CMQW (3.6 ± 0.19^b cm) was not similar with the result of control (7.6 ± 0.31^a cm), it was found to be very much significant in comparison to CMQW (1.4 ± 0.12^c cm) alone. Genotoxicity assessment revealed a significant reduction in the mitotic index of CMQW unlike control and detoxified CMQW. Mitotic index (%) of control, detoxified CMQW and CMQW was estimated to be 41.45 ± 1.71^c, 30.25 ± 3.33^a and 16.27 ± 1.83^b respectively. Inhibition of mitotic index after exposure to metal ions might be due to the disturbed cell cycle (blocking of G1 stage, inhibition/suppression of DNA synthesis) or dysfunction of chromatin (Gupta et al. 2018). Present findings showed an increase in significant chromosomal abnormalities due to toxic CMQW on the onion root cells (Table 3), leading to both physiological (stickiness, c-mitosis, lagging, vagrant) and clastogenic aberrations (fragments, bridges) (Gupta et al. 2018). Many workers have extensively employed micronucleus and chromosomal aberration assay in onion root meristematic cells to validate the toxicological efficacy of environmental pollutants (Silveira et al. 2018; Gupta et al. 2018). However, the most common chromosomal aberration was observed due to the dysfunction of chromatin causing bridge formation, stickiness, and failure of the spindle (c-mitosis and laggard chromosome) which leads to high chance of aneuploidy (Leme and Morales 2009). It was evident from genotoxic assessment (Fig. 8) that elevated metalloid present in CMQW reduced the mitotic index as well as enhanced chromosomal aberrations in the root meristem unlike control and detoxified CMQW.

Table 3

Chromosomal aberration of *A.cepa* L. root cells under various treatment conditions
Chromosomal aberrations in A. cepa L. root cells	Control	Detoxified CMQW	CMQW
MI (%)	41.45 ± 1.71^c	30.25 ± 3.33^a	16.27 ± 1.83^b
CAI (%)	01.06 ± 0.66^c	05.33 ± 2.23^b	28.15 ±5.56^a
NAI (%)	00.25 ± 0.16^c	02.04 ± 0.69^b	13.36 ± 3.40^a
MN (%)	0.18 ± 0.15^c	01.21 ± 0.59^b	09.64 ± 2.85^a
Chromosomal aberration data of different treatments were represents as mean ± SD (n=9), followed by Tukey’s test. Different letters as superscripts of respective rows denote significant difference between the means of treatments and same superscripts denotes means difference is not significant at p < 0.05.

In the present study, isolated strain Rhizobium pusense CR02 has shown the remediation capacity against high concentration of Cr(VI). The remediation capacity might be attributed due to high EPS production and its strong chromate reductase activity. However, the involvement of three localized chromate reductase enhanced the enzymatic reduction. Further, elevated antioxidant level reflected resistance capacity of the strain against Cr(VI) toxicity. Changes in functional groups and negative surface charge supported the interaction and bioaccumulation of Cr(VI), hence assist the bioconversion of Cr(VI) into Cr(III). Genotoxicity study confirmed substantial detoxification of CMQW by indigenous isolate. The study provided new insights on mechanisms of Cr(VI) reduction by Rhizobium pusense CR02, which may have great potential for ex-situ and in-situ bioremediation of Cr(VI) contaminated wastewater.

Credit author statement Hrudananda Sahoo: Conceptualization, methodology, execution of all experiments, data analysis, validation, manuscript writing, review and editing. Kanika Kisku, Kumar S. K. Varadwaj, and Prasannajit Acharya: Data analysis, review, and editing. Umesh Chandra Naik: Conceptualization, validation of data, review, and editing.

Acknowledgments We would like to express our sincere thanks to SERB, Govt. of India (YSS/2015/001089) for the financial support. We would also acknowledge University Grants Commission (UGC), Govt. of India for providing Fellowship. We would also like to acknowledge CIF, OUAT, Bhubaneswar for ICP-OES and Zeta potential analysis; CSIR-NIIST, Thiruvananthapuram, Kerala for XPS analysis, and ILS, Bhubaneswar for DNA sequencing facilities. We are also highly thankful to the research scholars from Department of Chemistry and Department of Geology at Ravenshaw University, for their help in FESEM-EDX, XRD, FTIR analyses and preparation of location map. We are also very much thankful to Dr. Bairagi Charan Mallick, Asst. Prof., Department of Chemistry at Ravenshaw University for Ultrasonication facility.

Ethics approval Not applicable.

Consent to participate Not applicable.

Consent for publication Not applicable.

Conflict of interest The authors declare no competing interest.

Aebi H (1984) Catalase in vitro methods. Enzymol 105:121–126
Aguilar-Barajas E, Paluscio E, Cervantes C, Rensing C (2008) Expression of chromate resistance genes from Shewanella sp. strain ana-3 in Escherichia coli. FEMS Microbiol Lett 285:97–100. DOI: 10.1111/j.1574-6968.2008.01220.x
Aljuboori AHR, Idris A, Abdullah N, Mohamad R (2013) Production and characterization of a bioflocculant produced by Aspergillus flavus. Bioresour Technol 127:489–493. DOI: 10.1016/j.biortech.2012.09.016
Allegretti P, Furlong J, Donati E (2006) The role of higher polythionates in the reduction of chromium (VI). J Biotechnol 122:55–61. DOI: 10.1016/j.jbiotec.2005.08.031
APHA (2012) Standard methods for the examination of water and waste water, 22nd ed; American public health association. American water works association, Water environment federation
Ataabadi M, Hoodaji M, Tahmourespour A, Kalbasi M, Abdouss M (2015) Optimization of factors affecting hexavalent chromium removal from simulated electroplating wastewater by synthesized magnetite nanoparticles. Environ Monit Assess 187:4165. DOI: 10.1007/s10661-014-4165-z
Ayangbenro AS, Babalola OO, Aremu OS (2019) Bioflocculant production and heavy metal sorption by metal resistant bacterial isolates from gold mining soil. Chemosphere 231:113–120. DOI: 10.1016/j.chemosphere.2019.05.092
Batool R, Yrjala K, Shaukat K, Jamil N, Hasnain S (2015) Production of EPS under Cr(VI) challenge in two indigenous bacteria isolated from a tannery effluent. J Basic Microbiol 55:1064–1074. DOI: 10.1002/jobm.201400885
Biswas J, Bose P, Mandal S, Paul AK (2018) Reduction of hexavalent chromium by a moderately halophilic bacterium, Halomonas smyrnensis KS802 under saline environment. Environ Sustain 1:411–423. https://doi.org/10.1007/s42398-018-00037-x
Biswas P, Karn AK, Balasubramanian P, Kale PG (2017) Biosensor for detection of dissolved chromium in potablewater: A Review. Biosens Bioelectron 94:589–604. DOI:10.1016/j.bios.2017.03.043
Bradford MMA (1976) Rapid and sensitive method for the quantitation of microgram quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 72:248–254. DOI: 10.1006/abio.1976.9999
Bramhachari PV, Dubey SK (2006) Isolation and characterization of exopolysaccharide produced by Vibrio harveyi strain VB23. Lett Appl Microbiol 43:571–577. https://doi.org/10.1111/j.1472-765X.2006.01967.x
Bruins MR, Kapil S, Oechme FW (2000) Microbial resistance to metallothionein in the environment. Environ Microbiol 45:351–364
Camargo FAO, Bento FM, Okeke BC, Frankenberger WT (2003) Chromate reduction by chromium-resistant bacteria isolated from soils contaminated with dichromate. J Environ Qual 32:1228–1233. DOI: 10.2134/jeq2003.1228
Chance B, Maehly AC (1955) Assay of catalases and peroxidases. Methods Enzymol 2:773–775
Chauhan LKS, Saxena PN, Gupta SK (1999) Cytogenetic effects of cypermethrin and fenvalerate on the root meristem cells of Allium cepa. Environ Exp Bot 42:181–189. DOI: 10.1016/S0098-8472(99)00033-7
Chen Y, An D, Sun S, Gao J, Qian L (2018) Reduction and removal of chromium VI in water by powdered activated carbon. Mater (Basel) 11:269. DOI: 10.3390/ma11020269
Cheung KH, Gu JD (2003) Reduction of chromate (CrO₄^2–) by an enrichment consortium and an isolate of marine sulfate reducing bacteria. Chemosphere 52:1523–1529. DOI: 10.1016/S0045-6535(03)00491-0
Cheung KH, Ji-Dong GU (2007) Mechanism of hexavalent chromium detoxification by microorganisms and bioremediation application potential: A Review. Int Biodeterior Biodegrad 59:8–15. DOI: 10.1016/j.ibiod.2006.05.002
Cosgrove DJ (1997) Relaxation in a high-stress environment: the molecular bases of extensible cell walls and cell enlargement. Plant Cell 9:1031–1041. DOI: 10.1105/tpc.9.7.1031
Das AP, Singh S (2011) Occupational health assessment of chromite toxicity among Indian miners. Indian. J Occup Environ Med 15:6–13. DOI:10.4103/0019-5278.82998
Das S, Behera BC, Mohapatra RK, Pradhan B, Sudarshan M, Chakraborty A, Thatoi H (2021) Reduction of hexavalent chromium by Exiguobacterium mexicanum isolated from chromite mines soil. Chemosphere 282:131135. DOI: 10.1016/j.chemosphere.2021.131135
Das S, Mishra J, Das SK, Pandey S, Rao DS, Chakraborty A, Sudarshan M, Das N, Thatoi H (2014) Investigation on mechanism of Cr (VI) reduction and removal by Bacillus amyloliquefaciens, a novel chromate tolerant bacterium isolated from chromite mine soil. Chemosphere 96:112–121. https://doi.org/10.1016/j.chemosphere.2013.08.080
Das S, Patnaik SC, Sahu HK, Chakraborty A, Sudarshan M, Thatoi HN (2013a) Heavy metal contamination, physico-chemical and microbial evaluation of water samples collected from chromite mine environment of Sukinda, India. T Nonferr Metal Soc 23:484–493. https://doi.org/10.1016/S1003-6326(13)62489-9
Das S, Ram SS, Sahu HK, Rao DS, Chakraborty A, Sudarshan M, Thatoi HN (2013b) A study on soil physico-chemical, microbial and metal content in Sukinda chromite mine of Odisha, India. Environ Earth Sci 69:2487–2497. doi:10.1007/s12665-012-2074-4
Dey S, Pandit B, Paul AK (2014) Reduction of hexavalent chromium by viable cells of chromium resistant bacteria isolated from chromite mining environment. J Min 1–8. DOI: 10.1155/2014/941341
Dey S, Paul AK (2012) Optimization of Cultural Conditions for Growth Associated Chromate Reduction by Arthrobacter sp. SUK1201 Isolated from Chromite Mine Overburden. J Hazard Mater 213–1214:200–206. DOI: 10.1016/j.jhazmat.2012.01.078
Dhal B, Das NN, Pandey BD, Thatoi HN (2011) Environmental quality of the boula-nuasahi chromite mine area in india. Mine Water Environ 30:191–196. DOI:10.1007/s10230-010-0134-0
Dubois M, Gilles KA, Hamilton JK, Rebers PA, Smith F (1956) Colorimetric method for determination of sugars and related substances. Anal Chem 28:350–356. DOI: 10.1021/ac60111a017
Equeenuddin SM, Pattnaik BK (2020) Hydrogeochemical evolution of hexavalent chromium at the sukinda ultramafic complex in eastern part of India. Geochemistry 80:125633. DOI: 10.1016/j.chemer.2020.125633
Ertani A, Mietto A, Borin M, Nardi S (2017) Chromium in agricultural soils and crops: A Review. Water Air Soil Pollut 228:190. DOI:10.1007/s11270-017-3356-y
Ewing JF, Janero DR (1995) Microplate superoxide dismutase assay employing a nonenzymatic superoxide generator. Anal Biochem 232:243–248. DOI: 10.1006/abio.1995.0014
Fendorf SE (1995) Surface reactions of chromium in soils and waters. Geoderma1 67:55–71. DOI: 10.1016/0016-7061(94)00062-F
Gomaa EZ (2012) Production and characteristics of a heavy metals removing bioflocculant produced by Pseudomonas aeruginosa. Pol J Microbiol 61:281–289
Grela E, Ząbek A, Grabowiecka A (2015) Interferences in the optimization of the MTT assay for viability estimation of Proteus mirabilis. Avicenna J Med Biotechnol 7:159–167
Gupta J, Rathour R, Dupont CL, Kaul D, Thakur IS (2021) Genomic insights into waste valorized extracellular polymeric substances (EPS) produced by Bacillus sp. ISTL8. Environ Res 192:110277. DOI: 10.1016/j.envres.2020.110277
Gupta J, Rathour R, Singh R, Thakur IS (2019) Production and characterization of extracellular polymeric substances (EPS) generated by a carbofuran degrading strain Cupriavidus sp. ISTL7. Bioresour Technol 282:417–424. DOI: 10.1016/j.biortech.2019.03.054
Gupta K, Mishra K, Srivastava S, Kumar A (2018) Cytotoxic assessment of chromium and arsenic using chromosomal behavior of root meristem in Allium cepa L. Bull Environ Contam Toxicol 100:803–808. DOI: 10.1007/s00128-018-2344-2
Gupta VK, Nayak A, Agarwal S (2015) Bioadsorbents for remediation of heavy metals: current status and their future prospects. Environ Eng Res 20(1):1–8
Henderson T (1994) Geochemical reduction of hexavalent chromium in the trinity sand aquifer. Ground Water 32:477–486. DOI: 10.1111/j.1745-6584.1994.tb00665.x
Holt JG, Krieg NR, Sneath PH, Staley JT, Williams ST (1994) Bergey’s manual of determinative bacteriology, 9th edn. William & Wilkins, Baltimor
Ilias M, Rafiqullah IM, Debnath BC, Mannan KSB, Hoq MM (2011) Isolation and characterization of Chromium (VI)-reducing bacteria from tannery effluents. Indian J Microbiol 51:76–81. https://doi.org/10.1007/s12088-011-0095-4
Indian Bureau of Mines (2015) Indian Minerals Year book 2015. Indian Miner. Year b. (Part-III Miner).Rev.54th Ed.1–9
Jachlewski S, Jachlewski WD, Linne U, Brasen C, Wingender J, Siebers B (2015) Isolation of extracellular polymeric substances from biofilms of the thermoacidophilic archaeon Sulfolobus acidocaldarius. Front Bioeng Biotechnol 3:23. DOI: 10.3389/fbioe.2015.00123
Jaishankar M, Tseten T, Anbalagan N, Mathew BB, Beeregowda KN (2014) Toxicity, mechanism and health effects of some heavy metals. Interdiscip Toxicol 7:60–72. DOI:10.2478/intox-2014-0009
Jena P, Mohanty S, Mohanty T, Kallert S, Morgelin M, Lindstrom T, Borregaard N, Stenger S, Sonawane A, Sorensen OE (2012) Azurophil granule proteins constitute the major mycobactericidal proteins in human neutrophils and enhance the killing of mycobacteria in macrophages. PLOSONE 7:e50345. DOI: 10.1371/journal.pone.0050345
Jin R, Wang B, Liu G, Wang Y, Zhou J, Jing W (2016) Bioreduction of Cr(VI) by Acinetobacter sp. WB-1 during simultaneous nitrification/denitrification process. J Chem Technol Biotechnol 92(3):649–656
Jobby R, Jha P, Yadav AK, Desai N (2018) Biosorption and biotransformation of hexavalent chromium [Cr(VI)]: A comprehensive review. Chemosphere 207:255–266. DOI: 10.1016/j.chemosphere.2018.05.050, PMID: 29803157
Kalsoom A, Batool R, Jamil N (2021) Highly Cr (VI)-tolerant Staphylococcus simulans assisting chromate evacuation from tannery effluent. Green Process Synth 10:295–308. DOI: 10.1515/gps-2021-0027
Kang C, Guo J, Guo P, Zhao Y, Dong D (2005) Pb²⁺ adsorption characteristics by organic components of biofilms and influencing factors in natural water. Chem. J Chin Univ 26:2043–2045
Kasprzak KS (2002) Oxidative DNA and protein damage in metal-induced toxicity and carcinogenesis. Free Radic Biol Med 32:958–967. DOI: 10.1016/s0891-5849(02)00809-2
Kathiravan MN, Karthick R, Muthu N, Muthukumar K, Velan M (2010) Sonoassisted microbial reduction of chromium. Appl Biochem Biotechnol 160:2000–2013. DOI:10.1007/s12010-009-8716-7
Khusro A, PreetamRaj JP, Panicker SG (2014) Study on antagonistic activity of a novel bacterial isolate under mild stress condition of certain antimicrobial agents. Eur J Exp Biol 4:26–30
Kotas J, Stasicka Z (2000) Chromium occurrence in the environment and methods of its speciation. Environ Pollut 107:263–283. DOI: 10.1016/s0269-7491(99)00168-2, PMID: 15092973
Kumar S, Stecher G, Li M, Knyaz C, Tamura K (2018) MEGA X: Molecular evolutionary genetics analysis across computing platforms. Mol Biol Evol 35:1547–1549. DOI: 10.1093/molbev/msy096
Lage OM, Bondoso J, Catita JA (2012) Determination of zeta potential in planctomycetes and its application in heavy metals toxicity assessment. Arch Microbiol 194:847–855. DOI: 10.1007/s00203-012-0818-x
Leme DM, Marin-Morales MA (2009) Allium cepa test in environmental monitoring: A review on its application. Mutat Res 682:71–81. DOI: 10.1016/j.mrrev.2009.06.002
Lenartova V, Holovska K, Javorsky P (1998) The influence of mercuryon the antioxidant enzyme activity of rumen bacteria Streptococcus bovis and Selenomonas ruminantium. FEMS Microbiol Ecol 27:319–325
Li J, Zheng T, Yuan D, Gao C, Liu C (2020) Probing the single and combined toxicity of PFOS and Cr(VI) to soil bacteria and the interaction mechanisms. Chemosphere 249:126039. DOI: 10.1016/j.chemosphere.2020.126039
Li N, Pan Y, Zhang N, Wang X, Zhou W (2016) The bio-reduction of chromate with periplasmic reductase using a novel isolated strain Pseudoalteromonas sp. CF10-13. RSC Adv 6:106600–106607. https://doi.org/10.1039/C6RA16320C
Liu H, Huang J, Zhang S, Xu B, Wang G (2015) Chromate interaction with the chromate reducing Actinobacterium Intrasporangium chromatireducens Q5-1. Geomicrobiol J 32:616–623. DOI: 10.1080/01490451.2014.971200
Mahbub KR, Krishnan K, Naidu R, Megharaj M (2017) Mercury remediation potential of a mercury resistant strain Sphingopyxis sp. SE2 isolated from contaminated soil. J Environ Sci 51:128–137. DOI: 10.1016/j.jes.2016.06.032
Maity S, Chatterjee A, Guchhait R, De S, Pramanick K (2020) Cytogenotoxic potential of a hazardous material, polystyrene microparticles on Allium cepa L. J Hazard Mater 385:121560. https://doi.org/10.1016/j.jhazmat.2019.121560
Mary Mangaiyarkarasi MS, Vincent S, Janarthanan S, SubbaRao T, Tata BVR (2011) Bioreduction of Cr(VI) by alkaliphilic Bacillus subtilis and interaction of the membrane groups. Saudi J Biol Sci 18:157–167. DOI: 10.1016/j.sjbs.2010.12.003
Ministry of Mines. India (2017) https://www.mines.gov.in/writereaddata/UploadFile/Mines_AR_2016-17_English.pdf. Annual report
Mishra H, Sahu HB (2013) Environmental scenario of chromite mining at sukinda valley- A Review. Int J Environ Eng Manag 4:287–292
Mishra R, Sinha V, Kannan A, Upreti RK (2012) Reduction of chromium-VI by chromium resistant Lactobacilli: A prospective bacterium for bioremediation. Toxicol Int 19:25–30. DOI: 10.4103/0971-6580.94512
Mishra S, Chen S, Saratale GD, Saratale RG, Romanholo Ferreira LFR, Bilal M, Bharagava RN (2021) Reduction of hexavalent chromium by Microbacterium paraoxydans isolated from tannery wastewater and characterization of its reduced products. J Water Process Eng 39:101748. DOI: 10.1016/j.jwpe.2020.101748
Mohanty JK, Rao DS, Paul AK, Khaoash S (2009) Characterization of high magnesian rocks for suitability as flux in iron and steel industry. J Geol Min Res 1:149–155
Mungasavalli DP, Viraraghavan T, Jin YC (2007) Biosorption of chromium from aqueous solutions by pretreated Aspergillus niger: batch and column studies. Colloids Surf A: Physicochem Eng Aspects 301:214–223. DOI: 10.1016/j.colsurfa.2006.12.060
Naik UC, Srivastava S, Thakur IS (2012) Isolation and characterization of Bacillus cereus IST105 from electroplating effluent for detoxification of hexavalent chromium. Environ Sci Pollut Res 19:3005–3014
Nayak SSRPB, Kale P (2020) A review of chromite mining in Sukinda valley of India: impact and potential remediation measures. Int J Phytoremediation 22:804–818. DOI: 10.1080/15226514.2020.1717432
Naz A, Chowdhury A, Mishra BK, Gupta SK (2016) Metal pollution in water environment and the associated human health risk from drinking water: a case study of Sukinda chromite mine, India. Hum Ecol Risk Assess Int J 22:1433–1455. DOI: 10.1080/10807039.2016.1185355
O’Toole GA, Kolter R (1998) Initiation of biofilm formation in Pseudomonas fluorescens WCS365 proceeds via multiple, convergent signalling pathways: A genetic analysis. Mol Microbiol 28:449–461. DOI: 10.1046/j.1365-2958.1998.00797.x
Ontanon OM, Fernandez M, Agostini E, Gonzalez PS (2018) Identification of the main mechanisms involved in the tolerance and bioremediation of Cr(VI) by Bacillus sp. SFC 500–1E. Environ Sci Pollut Res Int 25:16111–16120. DOI: 10.1007/s11356-018-1764-1
Pan X, Liu Z, Chen Z, Cheng Y, Pan D, Shao J, Lin Z, Guan X (2014) Investigation of Cr(VI) reduction and Cr(III) immobilization mechanism by planktonic cells and biofilms of Bacillus subtilis ATCC-6633. Water Res 55:21–29. DOI: 10.1016/j.watres.2014.01.066
Park D, Yun YS, Park JM (2008) XAS and XPS studies on chromium-binding groups of biomaterial during Cr(VI) biosorption. J Colloid Interface Sci 317:54–61. DOI: 10.1016/j.jcis.2007.09.049
Patra RC, Malik S, Beer M, Megharaj M, Naidu R (2010) Molecular characterization of chromium (VI) reducing potential in gram positive bacteria isolated from contaminated sites. Soil Biol Biochem 42:1857–1863. DOI: 10.1016/j.soilbio.2010.07.005
Prabhakaran DC, Bolanos-Benitez V, Sivry Y, Gelabert A, Riotte J, Subramanian S (2019) Mechanistic studies on the bioremediation of Cr(VI) using Sphingopyxis macrogoltabida SUK2c, a Cr(VI) tolerant bacterial isolate. Biochem Eng J 150:107292. DOI: 10.1016/j.bej.2019.107292
Prabhakaran DC, Subramanian S (2017) Studies on the bioremediation of chromium from aqueous solutions using C. paurometabolum. Trans Indian Inst Met 70:497–509. DOI: 10.1007/s12666-016-1009-2
Sahoo H, Kumari S, Naik UC (2021) Characterization of multi-metal-resistant Serratia sp. GP01 for treatment of effluent from fertilizer industries. Arch Microbiol 203:5425–5435. DOI: 10.1007/s00203-021-02523-z
Sahoo H, Senapati D, Thakur IS, Naik UC (2020) Integrated bacteria-algal bioreactor for removal of toxic metals in acid mine drainage from iron ore mines. Bioresour Technol Rep 11. PMID: 100422
Samuel J, Pulimi M, Paul ML, Maurya A, Chandrasekaran N, Mukherjee A (2013) Batch and continuous flow studies of adsorptive removal of Cr(VI) by adapted bacterial consortia immobilized in alginate beads. Bioresour Technol 128:423–430. DOI: 10.1016/j.biortech.2012.10.116
Saranya K, Sundaramanickam A, Shekhar S, Meena M, Sathishkumar RS, Balasubramanian T (2018) Biosorption of multiheavy metals by coral associated phosphate solubilising bacteria Cronobacter muytjensii KSCAS2. J Environ Manage 222:396–401. DOI: 10.1016/j.jenvman.2018.05.083
Saviour MN (2012) Environmental impact of soil and sand mining: A Review. Int J Sci Environ Technol 1:125–134
Schembri MA, Hjerrild L, Gjermansen M, Klemm P (2003) Differential expression of the Escherichia coli auto aggregation factor antigen 43. J Bacteriol 185:2236–2242. DOI: 10.1128/JB.185.7.2236-2242.2003
Schmid J, Sieber V (2015) Enzymatic transformations involved in the biosynthesis of microbial exo-polysaccharides based on the assembly of repeat units. Chem BioChem 16:1141–1147. DOI: 10.1002/cbic.201500035
Sheng GP, Yu HQ, Yue ZB (2005) Production of extracellular polymeric substances from Rhodopseudomonas acidophila in the presence of toxic substances. Appl Microbiol Biotechnol 69:216–222. DOI: 10.1007/s00253-005-1990-6
Silveira MAD, Ribeiro DL, Vieira GM, Demarco NR, d’Arce LPG (2018) Direct and indirect anthropogenic contamination in water sources: evaluation of chromosomal stability and cytotoxicity using the Allium cepa test. Bull Environ Contam Toxicol 100:216–220. DOI: 10.1007/s00128-017-2232-1
Srivastava S, Thakur IS (2012) Biosorption and biotransformation of chromium by Serratia sp. isolated from tannery effluent. Environ Technol 33:113–122. DOI: 10.1080/09593330.2011.551842
Stepanovic S, Vukovic D, Hola V, Di Bonaventura GD, Djukic S, Cirkovic I, Ruzicka F (2007) Quantification of biofilm in microtiter plates: overview of testing conditions and practical recommendations for assessment of biofilm production by Staphylococci. APMIS 115:891–899. DOI: 10.1111/j.1600-0463.2007.apm_630.x
Subudhi S, Batta N, Pathak M, Bisht V, Devi A, Lal B (2014) Bioflocculant production and biosorption of zinc and lead by a novel bacterial species, Achromobacter sp. TERI-IASST N, isolated from oil refinery waste. Chemosphere 113:116–124. https://doi.org/10.1016/j.chemosphere.2014.04.050
Subudhi S, Bisht V, Batta N, Pathak M, Devi A, Lal B (2016) Purification and characterization of exopolysaccharide bioflocculant produced by heavy metal resistant Achromobacter xylosoxidans. Carbohydr Polym 137:441–451. DOI: 10.1016/j.carbpol.2015.10.066
Tamura K, Stecher G, Peterson D, Filipski A, Kumar S (2013) MEGA6: Molecular evolutionary genetics analysis version 6.0. Mol Biol Evol 30:2725–2729. DOI: 10.1093/molbev/mst197
Tan H, Wang C, Zeng G, Luo Y, Li H, Xu H (2020) Bioreduction and biosorption of Cr(VI) by a novel Bacillus sp. CRB-B1 strain. J Hazard Mater 386:121628. DOI: 10.1016/j.jhazmat.2019.121628
Tsou TC, Lin RJ, Yang JL (1997) Mutational spectrum induced by chromium(III) in shuttle vectors replicated in human cells: relationship to Cr(III)–DNA interactions. Chem Res Toxicol 10:962–970. DOI: 10.1021/tx970040p
U.S. Geological Survey (USGS). Mineral Commodity Summaries (2018) U.S. Geological Survey (2018) DOI:10.3133/70194932
Upadhyay VP, Mishra RK, Quazi SP, Saio V (2020) Research Needs for Sustainable Productivity in Mining and Mineral Based Industries in Odisha, India. Advan Recyc Waste Manag 5:3. DOI: 10.37421/2475-7675.2020.5.165
Vendruscolo F, Ferreira GLR, Filho NRA (2016) Biosorption of hexavalent chromium by microorganisms. Int Biodeterior Biodegrad 119:87–95
WHO (2012) Guidelines for Drinking-Water Quality, 4th edn. World Health Organization
World Health Organization (2020) Chromium in Drinking-Water. World Health Organization, WHO/HEP/ECH/WSH/2020.3)
Zahoor A, Rehman A (2009) Isolation of Cr(VI) reducing bacteria from industrial effluents and their potential use in bioremediation of chromium containing wastewater. J Environ Sci (China) 21:814–820. DOI: 10.1016/s1001-0742(08)62346-3
Zhang L, Liu C, Li D, Zhao Y, Zhang X, Zeng X, Yang Z, Li S (2013) Antioxidant activity of an exopolysaccharide isolated from Lactobacillus plantarum C88. Int J Biol Macromol 54:270–275. DOI: 10.1016/j.ijbiomac.2012.12.037
Zhou S, Dong L, Deng P, Jia Y, Bai Q, Gao J, Xiao H (2017) Reducing capacity and enzyme activity of chromate reductase in a ChrT engineered strain. Exp Ther Exp Ther Med 14:2361–2366. DOI: 10.3892/etm.2017.4775
Zhu Y, Yan J, Xia L, Zhang X, Luo L (2019) Mechanism of Cr(VI) reduction by Bacillus sp. CRB-1, a novel Cr(VI) reducing bacterium isolated from tannery activated sludge. Ecotoxicol Environ Saf 186:109792. DOI: 10.1016/j.ecoenv.2019.109792
Zhu Y, Yan J, Xia L, Zhang X, Luo L (2019) Mechanism of Cr(VI) reduction by Bacillus sp. CRB-1, a novel Cr(VI) reducing bacterium isolated from tannery activated sludge. Ecotoxicol Environ Saf 186:109792. DOI: 10.1016/j.ecoenv.2019.109792.

FigureSupplementaryESPR.doc

Download PDF

Reviews received at journal
24 Feb, 2022
Reviewers invited by journal
24 Feb, 2022
Editor invited by journal
17 Feb, 2022
Editor assigned by journal
08 Feb, 2022
First submitted to journal
01 Feb, 2022

You are reading this latest preprint version

Mechanism of Cr(VI) reduction by an indigenous Rhizobium pusense CR02 isolated from chromite mining quarry water (CMQW) at Sukinda valley, India

Status:

Version 1

Abstract

Figures

Introduction

Materials And Methods

Results And Discussion

Conclusion

Declarations

References

Supplementary Files

Status:

Version 1