Animals
Male Wistar albino rats weighing 190-220 g (n= 47) were obtained from the Animal Care Center, College of Pharmacy, King Saud University (Riyadh, Saudi Arabia). Animals were fed with a standard chow pellet diet and had free access to water under controlled conditions (25◦C and a 12 h light/dark cycle).
Developing a hypoglycemic-hypertensive rat model
Healthy male rats group (n= 15) was divided into five groups (n= 3 for each group) and treated with several doses of insulin glargine (InG) (Lantus SoloSTAR®) (0, 10, 15, 20, 25units/kg/day, subcutaneous) to produce a hypoglycemic-hypertensive rat model for further investigation of hypoglycemia-induced CVD. Blood glucose (BG) levels and systemic hemodynamic functions were monitored using a glucometer (ACCU-Chek Performa) and BP-2000 Blood Pressure Analysis SystemTM (Visitech Systems), respectively.
Treatment
For chronic treatment, we had six groups of male rats. The, first three groups received saline (n= 5), D-carnitine (DC, Sigma, St Louis, MO, USA) (n= 5) at dose of 500mg/kg/day, intraperitoneal (i.p.) for carnitine depletion as mentioned earlier [20], or acetyl-L-carnitine (ALCAR, Sigma, St Louis, MO, USA) (n= 5) at a dose of 300mg/kg/day, i.p. for 15 days. In the last three groups, rats had pretreatment conditions for 5 days with saline, DC (500mg/kg/day, i.p.), or ALCAR (300mg/kg/day, i.p.). Then, they were treated with InG for 10 days with saline (InG+saline) (n= 6), DC (InG+DC) (n= 5) or ALCAR (InG+ALCAR) (n= 6), respectively. At the day of surgery, all rats were anesthetized with ketamine and xylazine (ketamine 100mg/kg and xylazine 10mg/kg, i.p.). Then, rat’s chest was opened by aseptic and sharp surgical scissors and forceps. Blood samples were collected directly from the heart. Rats were euthanized by exsanguination from the heart. Throughout the treatment course, BG levels, blood pressure and heart rate were monitored before (day 0) and during treatment (day 3, 6 and 9).
Measurement of carnitine levels in the heart
Following previous analytical technique [21], total carnitine levels was assessed in cardiac tissues through the interaction between carnitine and acetyl-CoA with carnitine acetyltransferase enzyme leading to the production of acetyltransferase and CoA. The free CoA reacted with 5,5-dithiobis-(2-nitrobenzoic acid) (DTNB, Sigma, St Louis, MO, USA) and produced thiophenolate ions that was measured spectrophotometrically at 412 nm.
Real-time quantitative polymerase chain reaction (RT-PCR) assay
At the day of analysis, total RNA was extracted from the cardiac tissues of all treated groups using TRIzol reagent (Invitrogen®, USA), as per the manufacturer's instructions [22]. Following RNA isolation, cDNA was synthesized using the High Capacity cDNA synthesis reverse transcription kit (Applied Biosystems®, USA) and RT-PCR was performed using SYBR® Green PCR master mix (Applied Biosystems®, USA) as described before [22]. mRNA levels of cardiac hypertrophy markers [α-myosin heavy chain (α-MHC) and β-myosin heavy chain (β-MHC)] and oxidative stress (iNOS) were measured on the Applied Biosystems 7500 Real-Time PCR system (Applied Biosystems®, USA) [22]. All the primers were designed using PubMed database and purchased from Integrated DNA technologies (IDT, Coralville, IA) (Table 1). The data are shown as the fold change in mRNA expression levels normalized to β-actin as a loading control.
Table 1
Primers for Real Time PCR experiments.
Gene | Forward primer | Reverse primer |
α-MHC | TCCTTTATCGGTATGGAGTCTG | TGATCTTGATCTTCATGGTGCT |
β-MHC | ATCAAGGGAAAGCAGGAAGC | CCTTGTCTACAGGTGCATCA |
iNOS | CCCTTCCGAAGTTTCTGGCAGCAGC | GGGTGTCAGAGTCTTGTGCCTTTGG |
β-actin | CCAGATCATGTTTGAGACCTTCAA | GTGGTACGACCAGAGGCATACA |
Western blot analysis
Cardiac proteins were extracted using lysis buffer as described before [23]. Briefly, cardiac tissue was minced and homogenized in ice-cold lysis buffer mixed with a protease inhibitor cocktail. After lysate collection, protein concentration was identified using the Direct Detect® spectrometer (EMD Millipore, USA). The western blot technique was used to determine protein expression as described in our previous study [23]. We analyzed 25-50 μg on a 10% SDS-polyacrylamide gel electrophoresis (SDS-PAGE) for protein separation. All proteins were transferred from the gel to Immun-Blot® LV PVDF membrane (BioRad, USA) and blocked overnight at 4°C. The blots were incubated with anti-iNOS, anti-NAD(P)H Quinone Dehydrogenase-1 (NOQ1), Anti-Heme Oxygenase-I (HO-I) and Anti- Glutathione transferase (GSH) antibodies (Santa Cruz Biotechnology Inc., CA, USA) at 4°C overnight and then incubated with appropriate peroxide-conjugated secondary antibodies (Santa Cruz Biotechnology Inc., CA, USA). β-actin was used as a protein loading control.
Statistics
Data were expressed as mean ± SEM and analyzed by one-way or two-way analysis of variance (ANOVA) followed by Tukey-Kramer multiple comparison test when appropriate (GraphPad Prism 7). (P < 0.05) was considered statistically significant.