A story of MiR-199a-5p in small cell lung cancer cisplatin resistance

doi:10.21203/rs.3.rs-1321838/v1

Download PDF

Research Article

A story of MiR-199a-5p in small cell lung cancer cisplatin resistance

https://doi.org/10.21203/rs.3.rs-1321838/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Background Multidrug resistance (MDR) in small cell lung cancer (SCLC) is a clinical dilemma in chemotherapy. Autophagy has been found to be involved in the MDR of cancers. We hypothesized that miR-199a-5p regulated cisplatin-resistant SCLC by targeting autophagy.

Methods We validated the MDR of H446/EP using CCK-8. We tested the binding of miR-199a-5p to p62 using the Dual-Luciferase assay and validated the association of miR-199a-5p and p62 in SCLC samples. We overexpressed (OE) and knocked down (KD) miR-199a-5p in H446 and H446/EP and determined the expression of miR-199a-5p, autophagy-related proteins, and the formation of autophagolysosomes using QPCR, western blotting, and MDC staining respectively.

Results H446/EP was resistant to cisplatin, etoposide, paclitexal, epirubicin, irinotecan, and vinorelbine. Exposure of cisplatin at 5 μg/ml for 24 hours increased LC3II/LC3I, ATG5, p62, and the formation of autophagolysosomes in H446 cells, but not in H446/EP cells. The expression of miR-199a-5p was up-regulated in H446/EP compared to H446. MiR-199a-5p directly targeted the p62 gene. The expression of miR-199a-5p and p62 were correlated in SCLC samples. In H446 and H69PR, the OE of miR-199a-5p increased LC3II/LC3I, p62, and the formation of autophagolysosomes, but not ATG5, while the KD of miR-199a-5p decreased p62, but did not affect LC3II/LC3I, ATG5, and the formation of autophagolysosomes. In H446/EP, the OE of miR-199a-5p decreased p62 only.

Conclusions The regulation of p62-mediated autophagy by MiR-199a-5p was a potential mechanism of SCLC cisplatin resistance.

Immunology

MDR

H446

autophagy

MiR-199a-5p

cisplatin

p62

More than 80% of clinical lung cancer cases are diagnosed as non-small cell lung cancers (NSCLC) and only less than 20% as small cell lung cancer (SCLC) [1, 2], but NSCLC typically grow at a slower rate than SCLC and are difficult to be discovered until they have advanced [3]. As SCLC can be diagnosed at earlier stages, chemotherapy is the major treatment for SCLC instead of surgical treatment, resulting in more drug resistance issues [4]. Multidrug resistance (MDR) is an innate and/or acquired ability of cancer cells to survive against a wide range of chemotherapy drugs [5]. In clinical cancer chemotherapy, MDR has been one of the tough dilemmas. Cancer cells with MDR can expel the anti-cancer molecules outside the cells thereby reducing the absorption of the drug. Although research has revealed many potential mechanisms underlying MDR, the understanding of MDR is still lacking and no effective way has been found to solve the problem of MDR ideally [6]. Autophagy has been suggested to be one of the factors that might affect MDR [7-9]. It is characterized by a self-digestion pathway that activates lysosomes to degrade damaged or superfluous cell components in the cells [10, 11]. Studies have shown that autophagy prevents cells from apoptosis, hypoxia, and damage stress responses. As a complex cell behavior, autophagy involved many biological processes and might interfere with MDR pathways [12, 13].

In recent years, many naturally occurring compounds have been studied and implemented in the clinical therapy of human disease [14-18]. Accumulating evidence suggests that chemotherapy supplied by traditional medicine might achieve desirable outcomes in clinical cancer treatment, including higher efficiency and lower side effects [19] [20]. For example, the natural compound β-elemene has been shown to induce autophagy in cancer cells [21], at the same time, it can suppress the multidrug-resistant cell lines [22]. We believe that autophagy was one of the mechanisms of these multidrug-resistant effects. A better understanding of autophagy in multidrug-resistant cancer cells can provide evidence for the use of some of these pharmacological active compounds.

A microRNA (miRNA) miR-199a-5p has been found closely related to autophagy and drug resistance [23]. This miRNA plays roles in multiple cancers, including lung cancer [24-26], laryngeal cancer [27], colorectal cancer [28], etc. A previous study has found that miR-199a-5p inhibited protective autophagy and reversed chemoresistance by regulating DRAM1 protein in leukemia cells [29, 30]. Our preliminary bioinformatics study revealed that miR-199a-5p was one of the miRNAs associated with cisplatin actions. Therefore, we proposed that miR-199a-5p might mediate the effect of cisplatin on the autophagy of lung cancer cells. In the present study, we explored the correlation between autophagy and MDR development in small cell lung cancer cell (SCLC) H446 cells and investigated the role of miR-199a-5p in this process. Our data revealed the role of miR-199a-5p in the autophagy regulation of cisplatin resistance in SCLC.

2.1 Cell lines and cell culture

Small cell lung cancer cell (SCLC) line NCI-H446 [H446] (ATCC® HTB-171™) and H69PR (ATCC®CRL-11350™) were purchased from ATCC (Washington, USA). The cell lines were cultured using the RPMI‑1640 medium (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) with 10% FBS (Gibco; Thermo Fisher Scientific, Inc., Waltham, MA, USA) in a 37˚C 5% CO₂ incubator. The multidrug resistance H446 sub-cell line H446/EP was developed from H446 with increasing concentration selection of etoposide (Sigma-Aldrich, St. Louis, MO, USA) combined with cisplatin (Sigma-Aldrich, St. Louis, MO, USA), both increased from 50 ng/ml to a final dose of 1,000 ng/ml. The H446/EP obtained were cultured in the drug-free medium for over 10 generations before the experiments [31].

2.2 Cell viability assay

IC50 of Cell viability was determined using the Cell Counting Kit-8 (CCK-8, Sigma-Aldrich, St. Louis, MO, USA) assay as a previous study [32]. Briefly, cells were cultured in 96-well plates with drugs accordingly. At the endpoint of the exposure, the CCK-8 reagent (10 ml/well) was added. After 3 h of incubation at 37 ˚C, the absorbance at 450 nm was evaluated using a microplate reader (Bio-Rad, Model 680). The cisplatin, etoposide, paclitexal, epirubicin, irinotecan, and vinorelbine were purchased from Sigma-Aldrich (St. Louis, MO, USA).

2.3 Cell transfection

The overexpression (OE) and knockdown (KD) of miR-199a-5p were achieved by transfection of sh-miR-199a-5p vector or miR-199a-5p expression vector into cells respectively. Briefly, the miR-199a-5p or its shRNA coding sequence was cloned into the pLV-eGFP vectors. Negative expression control vectors (OENC) and shRNA control vectors (KDNC) were also constructed with the same vector. Lipofectamine® 2000 was used to transfect the cells. The transfection was validated by observing the GFP marker in the transfected cells. The vectors were purchased and constructed by Beyotime Biotechnology (Shanghai, China).

2.4 Western blotting assay

The protein expressions were analyzed using the western blotting assay as described previously [33]. Briefly, cells were lysed in the RIPA buffer (Sigma-Aldrich, St. Louis, MO, USA) plus protease inhibitor (Pierce Protease Inhibitor Mini Tablets, Thermo Fisher Scientific, Inc., Waltham, MA, USA). SDS-polyacrylamide gel electrophoresis (PAGE, Sigma-Aldrich, St. Louis, MO, USA) electrophoresis was used to separate the proteins in samples. Then the proteins were transferred to 0.2-μm polyvinylidene difluoride membranes (Thermo Fisher Scientific, Inc., Waltham, MA, USA). The membranes were blocked with blocking buffer (Pierce™ Protein-Free Blocking Buffer, Thermo Fisher Scientific, Inc., Waltham, MA, USA) for 1 h. The membranes were then incubated with primary antibodies at 4°C, overnight, and then secondary antibodies at room temperature for 2 h (dilution following the recommended concentration of the antibody respectively). The ECL Detection Reagent (Sigma-Aldrich, St. Louis, MO, USA) was used to visualize the target protein. The primary antibodies used in this study were as follows: LC3B (1:800, 2775S, Cell Signaling); P62/SQSTM1 (1:2500, 18420-1-AP, Protein Tech); ATG5 (1:1000, GTX113309, GeneTex), and β-Actin (1:5000, sc-1615) (Santa Cruz Biotechnology, Dallas, TX, USA). All the secondary antibodies were purchased from the Abcam (Cambridge, UK).

2.5 Autophagolysosomes observation

Monodansylcadaverine (MDC, Sigma-Aldrich, St. Louis, MO, USA) staining was used to observe autophagolysosomes as described previously [34]. Briefly, cells were cultured in a 6-well plate under testing conditions. At the endpoint of the exposure, the cells were incubated with MDC (50 µmol/L) for 30 min at 37 ˚C. Then the cells were washed with precooling phosphate-buffered saline (Sigma-Aldrich, St. Louis, MO, USA), followed by the observation using a fluorescence microscope (GXM UltraDIGI-SBMF1, USA). The signals were quantified using ImageJ software.

2.6 Real-time quantitative PCR.

The expression of miR-199a-5p was evaluated using real-time quantitative PCR (QPCR) as described previously [35]. Briefly, TRIzol reagent (Vazyme) was used to extract total RNA from cells following the manufacturer’s instructions. The target RNAs were reverse-transcribed to cDNA using the M-MLV-Reverse Transcriptase Kit (Sigma-Aldrich, St. Louis, MO, USA). Real-time PCR analysis was performed using KiCqStart® SYBR® Green qPCR ReadyMix™ (Sigma-Aldrich, St. Louis, MO, USA) with a Real-Time PCR platform (CFX96, BIO-RAD). All the PCR primers used in the study were synthesized by Thermo Fisher Scientific, Inc. (Waltham, MA, USA). The expression was normalized to RNU6-1 miRNA expression using the ^△△CT method. The PCR primers sequences were as follows. miR-199a-5p F: 5′‐ACACTCCAGCTGGGTGTCAGTTTGTCAAAT‐3′, R: 5′‐TGGTGTCGTGGAGTCG‐3′; RNU6-1 F: 5′-CTCGCTTCGGCAGCACA-3′, R: 5′-AACGCTTCACGAATTTGCGT-3′.

2.7 Dual-Luciferase Reporter Assay.

Firefly/Renilla Dual Luciferase Assay (Sigma-Aldrich, St. Louis, MO, USA) was used to test the binding of miR-199a-5p to wild-type (WT) or mutated coding sequence of p62 as previously described [36]. Briefly, cells were plated in a 96-well plate and negative plasmids or reporter plasmids with WT or mutated p62 sequence were transfected to cells. The sequences were shown in Fig.3 G2. After 48 h transfection, cells were lysed, and the luciferase signal was measured following the protocol with the microplate reader (GXM UltraDIGI-SBMF1, USA).

2.8 Tissue collection

Cancer tissues were collected from 30 patients with SCLC surgical treatment or biopsy from the Second Hospital of Hebei Medical University. Patients infoemation were listed in the supplementary materials. Samples were fixed, embedded in paraffin, and stored in 4°C. All donors were over 18 years old and have given formal consent to the use of their samples. The study has been approved by the Ethics Committee of the First Hospital of Hebei Medical University.

2.9 Immunochemistry staining

P62 (SQSTM1) staining was done by immunochemistry using SQSTM1Antibody (SQSTM1/p62 Antibody #5114). Briefly, paraffin-embedded tissue samples were deparaffinized in xylene, rehydrated through graded ethanols, and then submerged into the citric acid buffer for heat-induced antigenic retrieval, blocked with 10% bovine serum albumin, incubated with SQSTM1 primary antibodies at 4°C overnight, and developed using the DAKO ChemMate Envision Kit HRP (Dako-Cytomation, Carpinteria, CA, USA) followed by counterstaining with hematoxylin, dehydration, clearing and mounting.

2.10 Experimental repetition and statistical analysis

The CCK assay was repeated three times with 8 biological duplications. The other experiments were repeated three times with three biological duplications. Data are presented as means ± SD. Student’s t-test or one-way ANOVA analysis was used to analyzed significance. A P-value of 0.01 or lower was considered significant.

3.1 Validation of H446/EP MDR

The validation of the cell models is usually the first step of a pharmacological study [37]. In the preliminary study, we determined the DRIC (drug resistance indices for cancer) of multiple drugs in H446 using MTT assay. The DRIC of cisplatin, etoposide, paclitexal, epirubicin, irinotecan, and vinorelbine was 29.95, 58.45, 5.57, 9.80, 5.84, and 2.09 respectively (Supplementary Table 1). Therefore, the H446/EP was validated as an MDR cell line for H446. We hypothesized that the autophagy might account for the MDR ability of H446/EP. This study focused on the effect of cisplatin. According to the inhibition curve of the cisplatin on H446, we used cisplatin at 5 μg/ml in the subsequent study, because H446 was sensitive to cisplatin at 5 μg/ml and H446/EP was not.

3.2 Cisplatin induced autophagy in H446 but not H446/EP

To test the hypothesis, we determined three indicators for autophagy including the ratio of LC3II and LC3I expression, the level of ATG5, and the levels of p62. Results showed that cisplatin increased LC3II/LC3I, ATG5, and p62 in H446 cells, but not in H446/EP cells. This indicated that the drug resistance of cisplatin was resulted (at least partly) from the insensitivity of autophagy induction. In addition, compared to H446, H446/EP had a similar ratio of LC3II/LC3I, but a significantly lower level of ATG5 and p62. This suggested that after a long time of exposure to cisplatin, H446 might develop autophagy-associated MDR mechanisms (Fig.1A-D). To observe the cell activity of autophagy in the cells, we stained the autophagolysosomes with MDC. We found that autophagolysosomes were significantly increased in H446 after 24-hour exposure to cisplatin. However, autophagolysosomes were not significantly increased in H446/EP after 24-hour exposure to cisplatin (Fig.1E). This further confirmed that cisplatin-induced autophagy was altered in H446/EP.

3.3 MiR-199a-5p was upregulated in H446/EP

As mentioned above, miR-199a-5p was supposed to be involved in MDR. To test whether it was also associated with the drug resistance in H446, we compared the expression level of it in H446 and H446/EP. Results showed that the drug resistance selection increased the level of miR-199a-5p in H446 up to 1,000 times (Fig.2A). Such a remarkable increase in miR-199a-5p expression in H446/EP suggested that miR-199a-5p might play a potential role in the drug resistance of H446. We also exposed H446 or H446/EP to 5 μg/ml cisplatin. Both of the two cell lines were not changed in the level of miR-199a-5p (Fig.2A).

3.4 MiR-199a-5p directly targeted the p62 gene.

Our results have shown that the expression of p62 was down-regulated in H446/EP compared to H446, while the expression of miR-199a-5p was up-regulated in H446/EP compared to H446. Hence, we proposed that miR-199a-5p might target the p62 gene coding sequence directly. Therefore, we invested the sequence of p62 mRNA and miR-199a-5p and predicted a potential binding site. Results showed that miR-199a-5p might potentially bind to p62 mRNA with five consecutive base pairings including 4 C-G base pairs (Fig.2C). To test this binding, we conducted the Dual-Luciferase Reporter Assay in H446 to validate the predicted binding site. The Luciferase Reporter gene was cloned with a wild-type p62 or a p62 with mutations at the predicted site (Fig.2D). Results showed that the overexpression of miR-199a-5p reduced the luciferase signal of samples from cells with wild-type p62 coding sequence, but it failed to affect the luciferase signal of samples from cells with mutations at the predicted site (Fig.2B). This indicated that the miR-199a-5p only bond to wild-type p62 mRNA but not to mutated p62 mRNA. This experiment validated the direct binding of miR-199a-5p to p62 mRNA. We suggested that this binding leads to the subsequent degradation of the p62 mRNA, which is the mechanism for miR-199a-5p down-regulating p62 expression in H446 cells.

3.5 Validation of association of miR-199a-5p and p62 in SCLC tissues.

To further validate the association of miR-199a-5p and p62 in SCLC, we collected SCLC cancer tissues from 30 patients with SCLC surgical treatment or biopsy. The expression of p62 in SCLC samples was measured using the western blotting assay and the expression of miR-199a-5p in SCLC samples was determined using the QPCR assay. Subsequently, the correlation of p62 and miR-199a-5p expression in SCLC samples was calculated. Results showed that the expression of p62 was negatively correlated with the miR-199a-5p level (Fig.3A). In the tissue staining, we found that samples with lower levels of miR-199a-5p had stronger signals of p62 protein, while the samples with higher levels of miR-199a-5p showed weaker signals of p62 protein (Fig.3B). This further suggested that p62 expression might be negatively regulated by miR-199a-5p.

3.6 The knockdown and overexpression of miR-199a-5p in H446.

To explore the role of miR-199a-5p, we knocked down (KD) and overexpressed (OE) miR-199a-5p in H446. In H466, the knockdown slightly decreased miR-199a-5p but the overexpression increased miR-199a-5p up to 1,500 folds (Fig.4A). We determined the ratio of LC3II and LC3I expression, the level of ATG5, and the levels of p62 to measure the autophagy in H446 cells. Results showed that miR-199a-5p knockdown increased LC3II/LC3I and p62 in H446 cells, but ATG5 was not affected (Fig.4B-E). We also observed autophagy in the cells. The staining of the autophagolysosomes with MDC in H446 cells showed that the autophagolysosomes were significantly increased in H446 with the miR-199a-5p knockdown. The autophagolysosomes were increased only in the knockdown control but not the H446 with miR-199a-5p knockdown after 24-hour exposure to cisplatin. These results indicated that the miR-199a-5p might decrease p62 and the transformation of LC3I to LC3II. The decrease in miR-199a-5p can result in the insensitivity of H446 cells to cisplatin. To further explore the role of miR-199a-5p in H446, we overexpressed miR-199a-5p in H446 cells. Results revealed that, after miR-199a-5p overexpression, H446 showed a similar ratio of LC3II/LC3I and a similar level of ATG5. However, the expression of p62 was remarkably reduced (Fig.4G-J). We suggested that the high level of miR-199a-5p decreased p62 only, but the low level of miR-199a-5p increased p62 thereby promoted the transformation of LC3I to LC3II. The staining of the autophagolysosomes with MDC in H446 cells showed that both the control and the miR-199a-5p overexpression H446 had very low signals of autophagolysosomes, the 24-hour cisplatin exposure increased the signals of autophagolysosomes in control only (Fig.4K). The overexpression of miR-199a-5p unsensitized the H446 to cisplatin.

3.7 The knockdown and overexpression of miR-199a-5p in H446.

To explore the role of miR-199a-5p, we knocked down (KD) and overexpressed (OE) miR-199a-5p in H446/EP. In H466/EP, the knockdown decreased miR-199a-5p and the overexpression significantly increased miR-199a-5p (Fig.5A). We determined the ratio of LC3II and LC3I expression, the level of ATG5, and the levels of p62 to measure the autophagy in H446/EP cells. Results showed that miR-199a-5p knockdown increased LC3II/LC3I and p62 in H446/EP cells, but ATG5 was not affected (Fig.5B-E). We also observed autophagy in the cells. The staining of the autophagolysosomes with MDC in H446 cells showed that the autophagolysosomes were significantly increased in H446/EP with the miR-199a-5p knockdown. The autophagolysosome signals in the knockdown control with or without cisplatin were all low. The autophagolysosome signals in H446/EP with miR-199a-5p knockdown were not significantly increased after 24-hour exposure to cisplatin. We suggested that H446/EP had developed mechanisms that prevent autophagy induced by cisplatin. These results also further confirmed that the miR-199a-5p decreased p62. To further explore the role of miR-199a-5p in H446/EP, we overexpressed miR-199a-5p in H446/EP cells. Results revealed that, after miR-199a-5p overexpression, H446/EP showed a similar ratio of LC3II/LC3I and a similar level of ATG5. However, the expression of p62 was almost completely blocked (Fig.5G-J). The staining of the autophagolysosomes with MDC in H446/EP cells showed that both the control and the miR-199a-5p overexpression H446/EP had very low signals of autophagolysosomes, the 24-hour cisplatin exposure failed to make any changes in the signals of autophagolysosomes (Fig.5K). These data suggested that the effects of miR-199a-5p on H446 cells were eliminated by the long-time exposure selection of cisplatin.

3.8 The knockdown and overexpression of miR-199a-5p in H69PR

To explore the role of miR-199a-5p, we knocked down (KD) and overexpressed (OE) miR-199a-5p in H69PR. In H466, the knockdown slightly decreased miR-199a-5p but the overexpression increased miR-199a-5p up to 1,500 folds (Fig.6A). We determined the ratio of LC3II and LC3I expression, the level of ATG5, and the levels of p62 to measure the autophagy in H69PR cells. Results showed that miR-199a-5p knockdown increased LC3II/LC3I and p62 in H69PR cells, but ATG5 was not affected (Fig.6B-E). We also observed autophagy in the cells. The staining of the autophagolysosomes with MDC in H69PR cells showed that the autophagolysosomes were significantly increased in H69PR with the miR-199a-5p knockdown. The autophagolysosomes were increased only in the knockdown control but not the H69PR with miR-199a-5p knockdown after 24-hour exposure to cisplatin. These results indicated that the miR-199a-5p might decrease p62 and the transformation of LC3I to LC3II and the decrease in miR-199a-5p can result in the insensitivity of H69PR cells to cisplatin. To further explore the role of miR-199a-5p in H69PR, we overexpressed miR-199a-5p in H69PR cells. Results revealed that, after miR-199a-5p overexpression, H69PR showed a similar ratio of LC3II/LC3I and a similar level of ATG5. However, the expression of p62 was remarkably reduced (Fig.6G-J). The staining of the autophagolysosomes with MDC in H69PR cells showed that both the control and the miR-199a-5p overexpression H69PR had very low signals of autophagolysosomes, the 24-hour cisplatin exposure increased the signals of autophagolysosomes in control only (Fig.6K). These results indicated that overexpression of miR-199a-5p also unsensitized the H69PR to cisplatin.

Small cell lung cancer is a type of highly aggressive lung cancer. As it typically causes symptoms in early-stage patients, it can be discovered at earlier stages, therefore, chemotherapy drugs are usually implemented almost throughout the entire course of treatment, causing more chance for the cells to develop MDR [38]. Clinical cancer treatment involves many drugs that might potentially make a difference such as anesthetics [39-42]. The doses of chemotherapy are critical for the treatment of SCLC. In this study, we conducted a series of CCK-8 assays to determine the effective doses of five commonly used chemo agents including cisplatin, etoposide, paclitexal, epirubicin, and irinotecan with H446 and H446/EP. The CCK-8 assay was a simple-step cell viability assay with stable results [43] and has fewer steps than the MTT assay [44, 45]. Thus CCK-8 was conducive for our serious viability assay. The evaluation of IC₅₀ and DRIC revealed that H446/EP showed MDR property. In this study, we studied one of the typical chemotherapy drugs cisplatin using the H446/EP model.

Many previous studies have reported that cisplatin can induce MDR in H446 cells through multiple pathways [46, 47]. Our results demonstrated that the drug resistance to cisplatin was resulted (at least partly) from the insensitivity of autophagy induction. Accumulating literature reported that abnormal autophagy plays a critical role in cancer MDR development [48]. Nevertheless, to date, few researchers are studying the inhibition of autophagy in drug-resistant lung cancer cells. In the present study, we demonstrated that autophagy was involved in H446/EP, and the potential mechanism included the activation of LC3I/LC3II conversion, ATG5 expression, and p62 expression. LC3II conversed from LC3I has been wildly accepted to be associated with the movement of mature autophagosomes along microtubular tracks [49], while ATG5 has been one of the indicators for autophagy and it plays essential roles in the elongation and expansion of phagophore membrane. The downregulation of ATG5 could prevent the autophagosome from maturation and thereby block autophagy [50]. The p62 protein, also named SQSTM1, is involved in various signaling pathways and cellular functions including autophagy [51]. These three indicators combined with the MDC assay can be used to observed autophagy comprehensively. Our result showed that the combination of cisplatin and β-elemene can significantly increase the autophagy of multi-drug resistance sub-cell line H466/EP compared to the use of cisplatin alone.

Growing lines of evidence supported the abnormal expression of miR-199a-5p in MDR cell lines. A study showed that cisplatin-induced the decrease of miR-199a-5p expression in human osteosarcoma cells MG63 [52]. Another study reported that the expression of miR-199a-5p in leukemia cells from relapsed/refractory patients was lower than that from patients with complete remission [53]. However, our results showed that H446/EP expressed a higher level of miR-199a-5p. But the miR-199a-5p expression was not induced by short-time exposure of cisplatin. We suggested that the reaction of miR-199a-5p expression to cisplatin was cancer-type specific. Another striking finding of this study was that miR-199a-5p could directly bind to p62 mRNA resulting in the degradation of p62 in autophagy repressive H446/EP cells. The regulation of p62-mediated autophagy by MiR-199a-5p was found to be a potential mechanism of small cell lung cancer cisplatin resistance. In addition, the ATG5 protein was also critical in the regulations of autophagy. Although ATG5 was involved in the MDR of H446, our data suggested that it is not affected by miR-199a-5p.

Our study was the first paper that reported an abnormally high expression of miR-199a-5p in drug resistance lung cancer cells. This study is conducive to the development of miR-199a-5p as a potential biomarker for the occurrence of drug resistance in lung cancer cells. Our data suggested that miR-199a-5p could be a pharmacological target for p62 protein and it was critical in mediating autophagy regulation by cisplatin. The role of the miR-199a-5p in regulation of autophagy by cisplatin was illustrated in Fig.7. In addition, sodium homeostasis has been suggested to be involved in autophagy, but whether the role of sodium channels in cancer [54] is associated with autophagy, cisplatin, and MDR needs further investment.

The regulation of p62-mediated autophagy by MiR-199a-5p was a potential mechanism of SCLC cisplatin resistance.

overexpressed (OE)

knocked down (KD)

non-small cell lung cancers (NSCLC)

small cell lung cancer (SCLC)

multidrug resistance (MDR)

overexpressed negative control (OENC)

knockdown negative control (KDNC)

wild-type (WT)

monodansylcadaverine (MDC)

Availability of data and materials

The raw data of this study are provided from the corresponding author with a reasonable request.

Competing interests

The authors claimed that there is no conflict of interest.

Consent for publication

All the authors have given their consent for this publication.

Ethical approval

Ethical approval was sought from an ethics committee of Hebei Medical University before commencing this study.

Funding

This study was supported by the Hebei Medical University. The funder provided funding for the cost of the use of the equipment and the purchases of all materials.

Authors’ contributions

TL contributed to the design of the study and most experimental work. HZhang, ZW, SG, XZ, NW, and HZhu contributed to the data analysis and the drafting of the manuscript. HL supervised the project. All authors had given final approval of the version to be published.

Acknowledgments

None.

1. Skřičková J, Kadlec B, Venclíček O, Merta Z: Lung cancer. Casopis lekaru ceskych 2018, 157(5):226-236.

2. Bade BC, Dela Cruz CS: Lung Cancer 2020: Epidemiology, Etiology, and Prevention. Clinics in chest medicine 2020, 41(1):1-24.

3. Collins LG, Haines C, Perkel R, Enck RE: Lung cancer: diagnosis and management. American family physician 2007, 75(1):56-63.

4. Saltos A, Shafique M, Chiappori A: Update on the Biology, Management, and Treatment of Small Cell Lung Cancer (SCLC). Frontiers in oncology 2020, 10:1074.

5. Zahreddine H, Borden KL: Mechanisms and insights into drug resistance in cancer. Front Pharmacol 2013, 4:28.

6. Wu Q, Yang Z, Nie Y, Shi Y, Fan D: Multi-drug resistance in cancer chemotherapeutics: mechanisms and lab approaches. Cancer letters 2014, 347(2):159-166.

7. Xu Z, Jiang H, Zhu Y, Wang H, Jiang J, Chen L, Xu W, Hu T, Cho CH: Cryptotanshinone induces ROS-dependent autophagy in multidrug-resistant colon cancer cells. Chemico-biological interactions 2017, 273:48-55.

8. Zhang X, Chen X, Guo Y, Jia HR, Jiang YW, Wu FG: Endosome/lysosome-detained supramolecular nanogels as an efflux retarder and autophagy inhibitor for repeated photodynamic therapy of multidrug-resistant cancer. Nanoscale horizons 2020, 5(3):481-487.

9. Utaipan T, Athipornchai A, Suksamrarn A, Chunsrivirot S, Chunglok W: Isomahanine induces endoplasmic reticulum stress and simultaneously triggers p38 MAPK-mediated apoptosis and autophagy in multidrug-resistant human oral squamous cell carcinoma cells. Oncol Rep 2017, 37(2):1243-1252.

10. Mizushima N, Levine B, Cuervo AM, Klionsky DJ: Autophagy fights disease through cellular self-digestion. Nature 2008, 451(7182):1069-1075.

11. Feng Y, He D, Yao Z, Klionsky DJ: The machinery of macroautophagy. Cell Res 2014, 24(1):24-41.

12. Mishima Y, Terui Y, Mishima Y, Taniyama A, Kuniyoshi R, Takizawa T, Kimura S, Ozawa K, Hatake K: Autophagy and autophagic cell death are next targets for elimination of the resistance to tyrosine kinase inhibitors. Cancer Sci 2008, 99(11):2200-2208.

13. Hu YL, Jahangiri A, Delay M, Aghi MK: Tumor cell autophagy as an adaptive response mediating resistance to treatments such as antiangiogenic therapy. Cancer Res 2012, 72(17):4294-4299.

14. Chen G, Wang C, Wang J, Yin S, Gao H, Xiang LU, Liu H, Xiong Y, Wang P, Zhu X et al: Antiosteoporotic effect of icariin in ovariectomized rats is mediated via the Wnt/beta-catenin pathway. Experimental and therapeutic medicine 2016, 12(1):279-287.

15. Liu H, Xiong Y, Wang H, Yang L, Wang C, Liu X, Wu Z, Li X, Ou L, Zhang R et al: Effects of water extract from epimedium on neuropeptide signaling in an ovariectomized osteoporosis rat model. Journal of ethnopharmacology 2018, 221:126-136.

16. Liu H, Xiong Y, Zhu X, Gao H, Yin S, Wang J, Chen G, Wang C, Xiang L, Wang P et al: Icariin improves osteoporosis, inhibits the expression of PPARgamma, C/EBPalpha, FABP4 mRNA, N1ICD and jagged1 proteins, and increases Notch2 mRNA in ovariectomized rats. Experimental and therapeutic medicine 2017, 13(4):1360-1368.

17. Haixia W, Shu M, Li Y, Panpan W, Kehuan S, Yingquan X, Hengrui L, Xiaoguang L, Zhidi W, Ling O: Effectiveness associated with different therapies for senile osteopo-rosis: a network Meta-analysis. J Tradit Chin Med 2020, 40(1):17-27.

18. Wang C, Chen G, Wang J, Liu H, Xiong Y, Wang P, Yang L, Zhu X, Zhang R: Effect of Herba Epimedium Extract on Bone Mineral Density and Microstructure in Ovariectomised Rat. Journal of Pharmaceutical and Biomedical Sciences 2016, 6(5).

19. Zhang GN, Ashby CR, Jr., Zhang YK, Chen ZS, Guo H: The reversal of antineoplastic drug resistance in cancer cells by β-elemene. Chinese journal of cancer 2015, 34(11):488-495.

20. !!! INVALID CITATION !!! {Lee, 2018 #1347}.

21. Guan C, Liu W, Yue Y, Jin H, Wang X, Wang XJ: Inhibitory effect of β-elemene on human breast cancer cells. International journal of clinical and experimental pathology 2014, 7(7):3948-3956.

22. Deng M, Liu B, Song H, Yu R, Zou D, Chen Y, Ma Y, Lv F, Xu L, Zhang Z et al: β-Elemene inhibits the metastasis of multidrug-resistant gastric cancer cells through miR-1323/Cbl-b/EGFR pathway. Phytomedicine : international journal of phytotherapy and phytopharmacology 2020, 69:153184.

23. Li Y, Jiang W, Hu Y, Da Z, Zeng C, Tu M, Deng Z, Xiao W: MicroRNA-199a-5p inhibits cisplatin-induced drug resistance via inhibition of autophagy in osteosarcoma cells. Oncol Lett 2016, 12(5):4203-4208.

24. Ahmadi A, Khansarinejad B, Hosseinkhani S, Ghanei M, Mowla SJ: miR-199a-5p and miR-495 target GRP78 within UPR pathway of lung cancer. Gene 2017, 620:15-22.

25. Hua Q, Jin M, Mi B, Xu F, Li T, Zhao L, Liu J, Huang G: LINC01123, a c-Myc-activated long non-coding RNA, promotes proliferation and aerobic glycolysis of non-small cell lung cancer through miR-199a-5p/c-Myc axis. Journal of hematology & oncology 2019, 12(1):91.

26. Li Y, Wang D, Li X, Shao Y, He Y, Yu H, Ma Z: MiR-199a-5p suppresses non-small cell lung cancer via targeting MAP3K11. Journal of Cancer 2019, 10(11):2472-2479.

27. Li DJ, Wang X, Yin WH, Niu K, Zhu W, Fang N: MiR-199a-5p suppresses proliferation and invasion of human laryngeal cancer cells. European review for medical and pharmacological sciences 2020, 24(23):12200-12207.

28. Zhu QD, Zhou QQ, Dong L, Huang Z, Wu F, Deng X: MiR-199a-5p Inhibits the Growth and Metastasis of Colorectal Cancer Cells by Targeting ROCK1. Technology in cancer research & treatment 2018, 17:1533034618775509.

29. Li Y, Zhang G, Wu B, Yang W, Liu Z: miR-199a-5p Represses Protective Autophagy and Overcomes Chemoresistance by Directly Targeting DRAM1 in Acute Myeloid Leukemia. J Oncol 2019, 2019:5613417-5613434.

30. Chen PH, Liu AJ, Ho KH, Chiu YT, Anne Lin ZH, Lee YT, Shih CM, Chen KC: microRNA-199a/b-5p enhance imatinib efficacy via repressing WNT2 signaling-mediated protective autophagy in imatinib-resistant chronic myeloid leukemia cells. Chem Biol Interact 2018, 291:144-151.

31. Pan B, Chen Y, Song H, Xu Y, Wang R, Chen L: Mir-24-3p downregulation contributes to VP16-DDP resistance in small-cell lung cancer by targeting ATG4A. Oncotarget 2015, 6(1):317-331.

32. Wu Z, Ou L, Wang C, Yang L, Wang P, Liu H, Xiong Y, Sun K, Zhang R, Zhu X: Icaritin induces MC3T3-E1 subclone14 cell differentiation through estrogen receptor-mediated ERK1/2 and p38 signaling activation. Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie 2017, 94:1-9.

33. Liu X, Liu H, Xiong Y, Yang L, Wang C, Zhang R, Zhu X: Postmenopausal osteoporosis is associated with the regulation of SP, CGRP, VIP, and NPY. Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie 2018, 104:742-750.

34. Xue JF, Shi ZM, Zou J, Li XL: Inhibition of PI3K/AKT/mTOR signaling pathway promotes autophagy of articular chondrocytes and attenuates inflammatory response in rats with osteoarthritis. Biomedicine & pharmacotherapy = Biomedecine & pharmacotherapie 2017, 89:1252-1261.

35. Li X, Peng B, Zhu X, Wang P, Xiong Y, Liu H, Sun K, Wang H, Ou L, Wu Z et al: Changes in related circular RNAs following ERbeta knockdown and the relationship to rBMSC osteogenesis. Biochemical and biophysical research communications 2017, 493(1):100-107.

36. Clément T, Salone V, Rederstorff M: Dual luciferase gene reporter assays to study miRNA function. Methods in molecular biology (Clifton, NJ) 2015, 1296:187-198.

37. Li R, Xiao C, Liu H, Huang Y, Dilger JP, Lin J: Effects of local anesthetics on breast cancer cell viability and migration. BMC cancer 2018, 18(1):666.

38. Byers LA, Rudin CM: Small cell lung cancer: where do we go from here? Cancer 2015, 121(5):664-672.

39. Li R, Liu H, Dilger JP, Lin J: Effect of Propofol on breast Cancer cell, the immune system, and patient outcome. BMC anesthesiology 2018, 18(1):77.

40. Li R, Huang Y, Liu H, Dilger JP, Lin J: Comparing volatile and intravenous anesthetics in a mouse model of breast cancer metastasis. In., vol. 78: American Association for Cancer Research; 2018: 2162.

41. Liu H: A Prospective for the Potential Effect of Local Anesthetics on Stem-Like Cells in Colon Cancer. Biomedical Journal of Scientific & Technical Research 2020, 25(2):18927-18930.

42. Liu H: A clinical mini-review: Clinical use of Local anesthetics in cancer surgeries. The Gazette of Medical Sciences 2020, 1(3):030-034.

43. Liu H, Dilger JP, Lin J: Effects of local anesthetics on cancer cells. Pharmacology & Therapeutics 2020, 212:107558.

44. Liu H, Dilger JP, Lin J: Lidocaine Suppresses Viability and Migration of Human Breast Cancer Cells: TRPM7 as A Target for Some Breast Cancer Cell Lines. Cancers 2021, 13(2):234.

45. Liu H, Dilger JP, Lin J: The Role of Transient Receptor Potential Melastatin 7 (TRPM7) in Cell Viability: A Potential Target to Suppress Breast Cancer Cell Cycle. Cancers 2020, 12(1).

46. Li W, Shi Y, Wang R, Pan L, Ma L, Jin F: Resveratrol promotes the sensitivity of small-cell lung cancer H446 cells to cisplatin by regulating intrinsic apoptosis. Int J Oncol 2018, 53(5):2123-2130.

47. Liu HN, Qie P, Yang G, Song YB: miR-181b inhibits chemoresistance in cisplatin-resistant H446 small cell lung cancer cells by targeting Bcl-2. Archives of medical science : AMS 2018, 14(4):745-751.

48. Li YJ, Lei YH, Yao N, Wang CR, Hu N, Ye WC, Zhang DM, Chen ZS: Autophagy and multidrug resistance in cancer. Chinese journal of cancer 2017, 36(1):52.

49. Xie R, Nguyen S, McKeehan WL, Liu L: Acetylated microtubules are required for fusion of autophagosomes with lysosomes. BMC cell biology 2010, 11:89.

50. Arakawa S, Honda S, Yamaguchi H, Shimizu S: Molecular mechanisms and physiological roles of Atg5/Atg7-independent alternative autophagy. Proceedings of the Japan Academy Series B, Physical and biological sciences 2017, 93(6):378-385.

51. Tao M, Liu T, You Q, Jiang Z: p62 as a therapeutic target for tumor. European journal of medicinal chemistry 2020, 193:112231.

52. Li Y, Jiang W, Hu Y, Da Z, Zeng C, Tu M, Deng Z, Xiao W: MicroRNA-199a-5p inhibits cisplatin-induced drug resistance via inhibition of autophagy in osteosarcoma cells. Oncology letters 2016, 12(5):4203-4208.

53. Li Y, Zhang G, Wu B, Yang W, Liu Z: miR-199a-5p Represses Protective Autophagy and Overcomes Chemoresistance by Directly Targeting DRAM1 in Acute Myeloid Leukemia. J Oncol 2019, 2019:5613417-5613417.

54. Liu H: Nav channels in cancers: Nonclassical roles. Global Journal of Cancer Therapy 2020, 6(1):5.

Supplementary Materials are not available with this version.

Download PDF

Version 1

posted

You are reading this latest preprint version

A story of MiR-199a-5p in small cell lung cancer cisplatin resistance

Status:

Version 1

Abstract

Figures

1. Background

2. Methods

3. Results

4. Discussion

5. Conclusions

Abbreviations

Declarations

References

Supplementary Materials

Status:

Version 1