Cell culture
In this study, Hippocampal neuronal cell line (HT-22 cell line) was kindly gifted from Weilin Jin (Shanghai Jiao Tong University). HT-22 cells were cultured in DMEM/F12 medium containing with 10% fetal bovine serum (all from Gibco), 100 U/mL penicillin and 100 μg/mL streptomycin (#C0222, Beyotime, China). All these cells were passaged by trypsin (TrypLE™, 12563-01, Thermofisher, US) when cells grew over 90%. The cells were re-seeded into a culture dish with 10% density. The cells should be put into a cell incubator with 5% CO2 and 37°C humid air after treatments.
Erastin treatment and transient transfection:
In this study, HT-22 cells were added with neuron injury induced drug (erastin, 0.5 μM, #S7242, Selleck, US) for 8 hours to build a neuron injury model. Propofol (50 μM, P-076, Sigma, Germany)(Jan et al., 2009) as a protective drug was added into medium two hours before neuron injury induced drug adding. Ferroptosis specific inhibitor (Ferrostain-1, 1 μM, S7243, Selleck, US) were used in different experiments.
Cells were seeded onto a culture dish and transfected with mouse ALOX5 OE or ALOX5 mutation plasmids (Ser663Ala, Ser at 663th amino acid site change to Ala) at 50 nM using Lipofectamine 2000 (Invitrogen, US) for 6 hours according to the instructions.
Cell viability and cell necrosis rate:
The CCK-8 kit only detects indirect cell viability. Almost 5000 WT-ALOX5 or Ser663Ala cells/100 μl were seeded into 96-well-plate per well, cells were treated with erastin for 8 hours in the presence of propofol. Then, 10 μl CCK-8 reagent was added into per well. After 2 hours incubated with CCK-8 reagent, the indirect viability could be measured by a microplate reader (Molecular Devices, US) at 450 nm.
PI/Hoechst 33342 staining ((PI, P4170, sigma, Germany), (Hoechst, #b2261, sigma, Germany)) and CCK-8 (#C0037, Beyotime, China) was used to detect cell necrosis rate in such study. In the PI/HO staining experiment, HT22 cells were seeded in the 24-wells-plates at a density of 1×105/ mL. After overnight incubated, pretreated with the indicated concentration of PPF for 2 h before erastin adding. After 8 h treatments of erastin, cells were incubated with 5 μg/mL PI and 10 μg/mL Hoechst 33342 for 15 min. The results were captured by Olympus fluorescence microscope. Cell necrosis rate was calculated by PI (+)/Hoechst (+).
ROS and lipid peroxides measurements:
Dihydroethidium (DHE) staining method was used to measure erastin induced intracellular ROS formation in this study. At first, HT-22 cells were treated with erastin, propofol, and Ferrostain-1. Then, DHE was added into the medium at a final concentration of 10 μM. After incubated for 30 mins, cells were washed by PBS one time. Different color pictures could be observed and taken by a fluorescence microscope. And these pictures were transferred to data by ImageJ software. To detect lipid peroxidation level, cells were treated as previously described and then incubated with 1 μM BODIPY 581/591 C11 (Invitrogen, US) for 30 min. After incubation, cells were washed by PBS one time. Then cells were incubated by trypsin and were resuspended by 400 μL PBS. At least 10000 cells were detected and analyzed by a fluorescent microplate reader (Molecular Devices, ID3) for lipid peroxides at 530 nm and 585 nm.
Immunofluorescences
4-HNE staining method was used to determine lipid oxidant levels, p-ALOX5 staining was used to identify the nucleated location in HT-22 cells. After previous cell treatment, cells were fixed in 4% paraformaldehyde for 15 min and then were permeabilized by Triton X-100 for 5 min. Next, cells were blocked by 10% donkey serum for 1 h. After blocking, cells were incubated with primary antibody ((4-HNE, #ab46545, Abcam, UK), (ALOX5 Ser663, #bs-3252R, Bioss)) overnight at 4°C. After incubating, cells were washed at 3 times by PBS and then incubated with Alexa Fluor 488–conjugated secondary antibody (#A11001, Invitrogen, US) at room temperature 1 hour. After DAPI staining, the samples were observed in a fluorescence microscope. All fluorescent intensity of pictures were transferred into data by Image J software.
Iron ion concentration measurement:
According to product instruction, intracellular iron ion (Fe2+) concentration in HT22 cells was stained with FeRhoNox-1 (Goryo, Japan). FeRhoNox-1 was dissolved in DMSO to make 1 mM stock solution, and then FeRhoNox-1 was diluted in HBSS (Gibco, US) to 5 μM working solution. After cells were incubated at 37°C for 30 min in the darkness, the pictures which contain color red and DAPI were taken by Olympus fluorescence microscope. In this study, microplate reader (Molecular Devices, ID3, US) was also used to get data, and fluorescence signal was observed at 570 nm.
Electron microscopy
For the measurement of mitochondrial structural changes, the electron microscopy method was used in HT-22 cells. After paraformaldehyde fixation, cells were processed and sectioned with a diamond knife on copper grids. Grids were examined with a Hitachi (Tokyo, Japan) electron microscope, and pictures were captured using a MegaView III digital camera.
qRT-PCR (Quantitative-real-time PCR)
Total RNA from HT22 cells was isolated by TRIzol (Invitrogen, US) according to product instructions. After RNA isolation, the PrimeScript RT kit (#RR037, Takara, Japan) was used to reverse-transcribe RNA into cDNA according to the product specification. Quantitative real-time PCR was performed using the two-step RT-PCR method by CFX connect (Bio-Rad, US). The sequences of Primers for RT-PCR of PTGS2 are TGCACTATGGTTACAAAAGCTGG (Forward Primer), TCAGGAAGCTCCTTATTTC CCTT (Reverse Primer).
Western blot
Total protein was lysed in ice-cold RIPA (#P0013B, Beyotime Biotechnology, China) containing protease and phosphatase inhibitor cocktail. The lysate was quantified by BCA protein assay kit (#23227, Thermo fisher, US). 35 μg protein was loaded into per well and was separated by SDS-PAGE. After electrophoresis (100 volt, 80 minutes), PVDF membranes (Millipore, Germany) were used to block all protein at 200 mA for 0.5-1 hour. Then, membranes were incubated with blocking buffer for 2 hours at room temperature. Then membranes were incubated with primary antibodies overnight at 4°C. After primary antibodies incubated, membranes were incubated with horseradish peroxidase–linked secondary antibodies for 1 hour. The protein membranes were taken by ChemiDoc Imaging System with the help of an ECL detection reagent (#34095, Thermo Fisher, US). The primary antibodies mentioned above contained p-PKA (ab75991, Abcam, UK), PKA (ab38949, Abcam, UK), p-MK2 (ab63378, Abcam, UK), MK2 (ab32567, Abcam, UK), p-ERK (#9101, CST, US), ERK (#9102, CST, US), ALOX5 (Ser663) (#bs-3252R, Bioss), ALOX5 (Ser271) (#3748, CST, US), ALOX5 (Ser523) (PA5-99150, Invitrogen), ALOX5(#ab169755, abcam), p53 (#ab32389, abcam, UK), xCT (ab175186, Abcam, UK), GPX4(ab125066, Abcam, UK), β-actin (#sc-47778, Santa Cruz, US)(Lu et al., 2019).
Statistical analysis:
In this study, we used PRISM 7.0 to analyze the data. And all the results were presented as means ± SD. ANOVA method or Student's t-test method was respectively used in statistical significances' analysis.