Parasite and cell Culture
T. gondii RH, ME49, Wh6, and Wh3 tachyzoites were cultured in human foreskin fibroblast (HFF) cells in Dulbecco’s modified Eagle’s medium (DMEM) which contained 10% fetal bovine serum (FBS) and 1% penicillin–streptomycin amphotericin B (Biological Industries, Israel). N2a cells were cultured and maintained in DMEM which contained 10% fetal bovine serum (FBS) and 1% penicillin–streptomycin amphotericin B (Biological Industries, Israel) at 37°C in a 5% CO2 humified atmosphere. Cells were serially passaged when they reached 80-90% confluency. HFF and N2a cells were regularly inspected for mycoplasma contamination.
Extraction of RNA and cDNA synthesis
Total RNA from T. gondii tachyzoites (RH, ME49, Wh6 and Wh3 strains) was obtained using TRIzol reagent (Invitrogen, SF, USA) following the manufacturer’s protocols. Extracts with A260/A280 and A260/A230 absorbance ratios between 1.92 and 2.20 were considered pure contaminating reverse transcriptase or DNA polymerase inhibitors and were examined on 1% agarose gels. The concentration of purified RNA was measured using a NanoDrop™ One (Thermo Scientific CA, USA). RNA extracts were stored in -80°C refrigerator for subsequent use. Complementary DNA (cDNA) was synthesized from total RNA samples to using RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher, USA) following the manufacturer’s recommendations. A 1:10 dilution of the cDNA reaction was prepared, measured, and stored at -20°C for use in subsequent steps.
Plasmid construction
The ORF encoding T. gondii GRA3 (http://toxodb.org) cDNA was amplified from Wh6 tachyzoite RNA using real-time (RT)-PCR. The oligonucleotides used included ME49-GRA3-Ecorl-GFP (5’- CGGAATTCATGGACCGTACCATATG 3’; the EcoR1 site is underlined) and the reverse primer ME49-GRA3- Sal1 -GFP (5’- GTCGACTTATTTCTTGG AGGCTTTG 3’; the Sal1 site is underlined). GRA3 primer synthesis and gene sequencing were performed by General Biosystems Co., Ltd. (Anhui, China). A pEGFP-C2 vector (BD Biosciences Franklin Lakes, NJ, USA) was used to construct the pEGFP-GRA3Wh6 plasmid by inserting digested TgGRA3Wh6 cDNA into the digested pEGFP-C2 vector. The resulting pEGFP-GRA3wh6 plasmid was transformed into E. coli TOP10 (Invitrogen Corp., U.S.A.) and screened.
Transfection of N2a cells with pEGFP and pEGFP-GRA3Wh6 cDNA
Plasmid transfection was performed using Lipofectamine 3000 transfection reagent (Thermo Fisher Scientific, China) in 6-well plates following the manufacturer’s instructions. In brief, cells were seeded at a density of 1 × 105 cells/ml in 6-well plates and cultured to reach between 70-90% confluency at the time of transfection. DNA plasmid (2.5 µg) was diluted in 125 µl Opti-MEM containing 5 µl P3000 reagent, and 5 µl Lipofectamine 3000 transfection reagent was diluted in 125 µl Opti-MEM. The diluted Lipofectamine 3000 transfection reagent and diluted DNA were mixed gently and incubated at room temperature for 15 min. Following incubation, a total of 250 µl DNA-lipid complex was gently pipetted into each well. Control wells contained only cultured N2a medium. Cells were incubated between 18-48 hr, and the expression levels of pEGFP and pEGFP-GRA3Wh6 were visualized using an Olympus IX51 fluorescence microscope (Japan). After transfection, the cells were treated and analyzed by immunoblotting unless otherwise indicated.
Induction of ER stress
ER stress and apoptosis in N2a cells were induced using 4 µg/ml tunicamycin (TM) and 0.5 µM staurosporine (STS), respectively (MedChemExpress LLC, Shanghai, China), following the manufacturer’s protocols.
Treatment with inhibitors
After seeding N2a cells for 24 hr, cells were pretreated with 4 µM GSK2656157 (MedChemExpress LLC, Shanghai, China) and 5 µM Z-ATAD-FMK (BioVision Inc., Milpitas, California) for 1.5 hr and 6 hr, respectively. Following pretreatment with inhibitors, Lipofectamine 3000 reagent was used to transfect cells with plasmids as previously described.
Apoptosis detection
Apoptosis of N2a cells was determined using the PE-Annexin V/7-AAD (BD Biosciences, USA) staining method following the manufacturer’s instructions. In brief, cells in each well were washed twice with cold PBS and harvested using 0.25% trypsin solution. Growth medium was added to inactivate trypsin. Supernatants from each well were transferred to Eppendorf tubes and centrifuged at 800 RPM for 3 min. Pellets were then resuspended in 100 µL 1X Annexin V binding buffer. Five µL of PE-Annexin V and 5 µL of 7-AAD were added to the cell suspensions and mixed gently. Cells were incubated in the dark at room temperature for 15 min. After incubation, 300 µL of Annexin V binding buffer was added to each test tube. Apoptosis of N2a cells was detected using a FACSCalibur flow cytometer (BD Biosciences, USA) within 1 hr, and the data were analyzed using FlowJo/CytExpert software. Annexin V+/7-AAD represented cells in the early-stage apoptosis, while annexin V+/7-AAD+ represented cells in the late-stage apoptosis. Mock-transfected cells represented negative control, whereas STS and TM treated cells served as positive controls.
Cell viability assay
Following transfection and/or pretreatment with inhibitors, 10 µl of CCK-8 reagent was added to cultured N2a cells in a 96-well plate and incubated for 1 hr. The absorbance of each well was determined by an absorbance microplate reader (Tecan Infinite F50, Switzerland) at a wavelength of 450 nm.
Immunoblotting
N2a cells were harvested 24 hr after plasmid transfection, and the expression levels of GRA3, protein kinase R (PRK)-like ER kinase (PERK), glucose regulated protein (GRP)-78, cleaved caspase 12, cleaved caspase 3 and C/EBP-homologous protein (CHOP) were determined by immunoblotting. In brief, cells were washed with cold PBS and lysed in RIPA lysis buffer (Beyotime Institute of Biotechnology, Jiangsu, China). The cell lysate was centrifuged at 16,000 g for 10 min at 4°C, and the supernatant was collected. Proteins (40 µg) were separated on 10 - 12% SDS–PAGE and transferred onto 0.45 µM nitrocellulose membranes (Millipore, Billerica, MA, USA). The blotting membranes were then blocked with 5% skimmed milk in 1X TBST for an hour and incubated with primary antibodies (1:1000 dilution) overnight at 4 ℃. Blots were subsequently incubated for 1 hr with respective secondary antibodies (1:4000 dilution) at room temperature. Blots were washed and probed with an ECL kit (Affinity Bioscience Ltd., Jiangsu, China). Images from blots were viewed using a Bio–Rad ChemiDoc XRS+ imaging system, and ImageJ software (Rawak Software, Inc., Stuttgart, Germany) was used to calculate the relative optical densities of each band. The relative protein expression levels were normalized to that of β-actin. Mock-transfected cells served as a negative control. Rabbit anti-caspase 12, rabbit anti-caspase 3, mouse anti-CHOP, mouse anti-β-actin, goat anti-rabbit IgG, and goat anti-mouse IgM were all purchased from Proteintech (Wuhan, Hubei, China). Rabbit anti-phospho-PERK (p-PERK) was purchased from Affinity Bioscience Ltd. (Jiangsu, China), and rabbit anti-PERK was purchased from Cell Signaling Technology Inc. (Danvers, Massachusetts, United States), rabbit anti-GRP78 was purchased from Abcam (Cambridge, United Kingdom), and rabbit anti-GFP was purchased from Santa Cruz Biotechnology (Dallas, Texas, USA).
Real Time-PCR
Total RNA was obtained from the cells by the TRIzol method as previously described. cDNA was synthesized from purified RNA using RevertAid First Strand cDNA Synthesis Kit (Thermo Fisher Scientific, USA). Reverse transcriptase quantitative polymerase chain reactions (RT–qPCR) were performed using SYBR Green ProTaq (Takara, Tokyo, Japan) following the manufacturer’s protocols. The forward and reverse primers listed in Table 1 were synthesized by General Biosystems Co., Ltd. (Anhui, China). Briefly, 1 µg of RNA was reverse transcribed to a 10 µL final volume master mix reaction. Two microliters of cDNA, 0.4 µL of forward and reverse primers, 5 µL of SYBR Green ProTaq and 2.2 µL of ddH2O were added to make a final reaction volume of 10 µL. PCR was carried out for 45 cycles of initial denaturation for 5 sec at 94°C, annealing for 15 sec at 55°C, and extension for 1 min at 72°C using a LightCycler 96 (Roche, Basel, Switzerland). All RT-qPCR reactions were carried out in triplicate. Gene expression levels were normalized to actin levels, and data were quantified with the delta-delta CT (ΔΔCT) method.
Table 1
Oligonucleotide sequences for Mus musculus genes and TgGRA3 (RT-qPCR)
Primer Name
|
Sequence (5’ to 3’)
|
Caspase 12-F
|
ACAAAGGGATAGCCACTGCT
|
Caspase 12-R
|
ACCAGTCTTGCCTACCTTCC
|
Caspase 3-F
|
AAGGAGCAGCTTTGTGTGTG
|
Caspase 3-R
|
GGCAGGCCTGAATGATGAAG
|
PERK - F
|
CGGCAGGTCCTTGGTAATCA
|
PERK – R
|
CGTCCAAATCCCACTGCTTT
|
CHOP (C/EBP) - F
|
TCGCTCTCCAGATTCCAGTC
|
CHOP (C/EBP) – R
|
ACTGACCACTCTGTTTCCGT
|
GRP78 – F
|
GGTGGGCAAACCAAGACATT
|
GRP78 – R
|
TCAGTCCAGCAATAGTGCCA
|
Actin - F
|
AACTAGGCTGCTCCCTGAAG
|
Actin - R
|
TGCAAAGGATCCCGCTTAGA
|
GRA3 - F
|
TTCTCGCCGCCTACTACATT
|
GRA3 - R
|
TGTGTCCAATCTGCGTCAAC
|
Abbreviations: PERK Protein Kinase R (PRK)-like ER Kinase, GRP78 78-kDa glucose-regulated protein, CHOP C/EBP homologous protein, GRA3 Dense Granule Proteins. |
Statistical analysis
Data are presented as mean ± SD of three or more independent experiments. A two-tailed independent Student’s t test was used to determine the differences between pEGFP- and pEGFP-GRA3Wh6-transfected N2a cells. One-way ANOVA was used to compare the GRA3 expression levels among RH, ME49, and Wh3 and Wh6 strains. A P value < 0.05 was considered statistically significant. Analysis was performed using GraphPad Prism 8 Version 8.02