Poultry ethics
The scientific and ethics committee of the Biological Application Department, Nuclear Research Center, Egyptian Atomic Energy Authority, approved all procedures used in this experiment, according to the guidelines of the National Institute of Animal Health for animal Care and Use in the experiments.
Insect Rearing, Harvest And Preparation Of Hermetia Illucens Meal
The Black Solder Fly, Hermetia illucens was reared and maintained in the insectaria building. The rearing conditions were 24 ± 2°C, 65 ± 5% relative humidity. The rearing system was started from adult flies that fed on diets consisting of 3:1 of sucrose: yeast hydrolyzate. For drinking, water cups were supplied in the rearing cages. The laid eggs were collected daily. The larvae of Hermetia illucens were reared on a semi-artificial diet that was developed by Tanaka et al. (1969) consisting of 28% wheat bran, 7% yeast, 13% sugar, 0.3% sodium benzoate, 1.5% HCl and 50.20% water. After 16 days, the newly formed Pre-Pupae were collected, ground using a blender (3.8 liter) (Hamiliton Beach blender model HBF900S, VA, USA) and then oven-dried at 40°C for 24 h. The resulting BSF meal was irradiated with an 80 krad dose rate using a Cobalt 60 gamma cell at a dose rate of 0.03 krad /min. Irradiation treatment is an effective phytosanitary treatment against various pathogens or unfavorable pests that may infect the insect meal, with minimal adverse effects on the quality of most fresh products (Organization, 1988). The H. illucens meal was kept and stored at room temperature used as ingredient in feeding experiments to formulate diets along with other ingredients.
Chemical analysis
The chemical compositions of soybean meal and Hermetia illucens meal were analyzed in triplicates. The crude protein, crude fat, crude fiber and ash contents of soybean meal and B. zonata meal were analyzed according to Association of Official Analytical Chemists (AOAC) methods (2012). The contents of the amino acids methionine, lysine and cysteine of soybean meal and B. zonata were analyzed by high-performance liquid chromatography (Beckman Instruments, Inc., Fullerton, CA, USA), where soybean and Hermetia illucens protein extracts was applied to a TSK 4000-SW column at a flow rate of 1.0 ml min-1 and measured at a detection wavelength of 280nm (0.02 AUFS). Proteins were eluted isocratically by 0.01 M potassium phosphate buffer (pH 7.4). The total lipids were extracted and purified according to Folch et al. (1957). Carbohydrate content was estimated according to the method by Albalasmeh et al.(2013). Gross caloric content was determined by using an Oxygen Bomb Calorimeter (Instrumentation India Co.). Calcium content was determined by Atomic absorption Spectrophotometry (Varian Tectron AA575 series). Inorganic phosphorus was determined colorimetrically using commercial Diamond kit produced by Stanbio Company, USA using a computerized spectrophotometer model Milton Roy 1201.
Birds and husbandry
The feeding experiments were conducted on Japanese quails chicks maintained at the poultry experimental farm of the Biological Application Department. A total of 300 Japanese quail chicks, 10 days-old and weighing 46 g on average were randomly allotted to three groups (100 chicks in each group, one group for each diet). Each group consisted of five pens as replicates. Each pen was 1.0 m wide Х 1.2 m long and was equipped with a feeder and an automatic drinker. All groups were farmed in electrically heat- controlled batteries: the first week the temperature was controlled at 35 ˚C, while 28 ± 2 ˚C was maintained after that until the end of the experiment. Relative humidity was 50 ± 5% and photoperiod was 14 L: 10 D hours. At the last week of experiment, 20 birds (10 ♂ and 10 ♀) in each group, were randomly selected, numbered and exposed for seven consecutive days to 40 ± 2°C for 8 h (from 9:00 to 16:00 a.m.) and then to 28 ± 2°C during the remaining experimental period.
Feeding experiments
Three iso-caloric and iso-nitrogenicfeeding treatments were conducted in comparison. In the first treatment, the quails were fed on a control diet based on yellow corn and soybean meal. In the second treatment, the quails were fed diet A, where 50% of the soybean meal protein was replaced with Hermetia illucens meal. In the third treatment, the quails were fed on diet B, where 100% of the soybean meal protein was substituted with Hermetia illucens meal. All diets were formulated to meet the nutrient requirements of Japanese quail according to NRC, (1994). The three feeding experiments lasted for 6 weeks. Feed and water were provided ad libitum throughout the experimental period. The calculated chemical composition of the control and experimental diets are given in Table 1.
Table 1
Composition and calculated analysis of experimental diets of growing Japanese quail.
| Experimental diets |
Ingredients [%] | Diet A (0% Hermetia illucens meal) | Diet B (50% Hermetia illucens meal) | Diet C (100% Hermetia illucens meal) |
Yellow corn | 42 | 55.5 | 66 |
Soybean meal (44%) | 46 | 19.5 | 0.0 |
Bactrocera zonata meal | 0.0 | 17.5 | 30.5 |
soybean oil | 9 | 4.2 | 0.0 |
DL-methionine | 0.15 | 0.15 | 0.1 |
Choline chloride | 0.05 | 0.2 | 0.2 |
L-Lysine | 0.0 | 0.25 | 0.5 |
Dicalcium phosphate | 0.8 | 0.5 | 0.5 |
Limestone | 1.4 | 1.6 | 1.8 |
Sodium chloride | 0.3 | 0.3 | 0.3 |
Vitamin and mineral premix1 | 0.3 | 0.3 | 0.3 |
Calculated values2 [%] | | | |
Crude protein | 24.08 | 24.01 | 24.09 |
Crude fibre | 4.14 | 4.49 | 4.78 |
Lysine | 1.45 | 1.3 | 1.26 |
Methionine | 0.53 | 0.59 | 0.58 |
Methionine + cysteine | 0.6 | 0.76 | 0.6 |
Calcium | 0.85 | 0.86 | 0.87 |
available phosphorus | 0.31 | 0.35 | 0.42 |
Metabolizable Energy (ME) MJ/kg | 13.37 | 13.57 | 13.58 |
1 vitamin-mineral premix provided per kg diet: IU: vit. A 4,000,000, vit. D3 500,000; g: vit. E 16.7, vit. K 0.67, vit. B1 0.67, vit. B2 2, vit. B6 67, vit. B12 0.004, nicotinic acid 16.7, pantothenic acid 6.67, biotin 0.07, folic acid 1.67, choline chloride 400, Zn 23.3, Mn 10, Fe 25, Cu 1.67, I 0.25, Se 0.033, Mg 133.4; 2 calculated according to National Research Council (1994)
Growth performance and carcass traits
The initial body weight of quail chicks at the beginning of study and the final body weight at the end of the experimental period (6 weeks), were recorded to calculate the body weight gain after the experimental period. At the end of the experimental period of 42 days, 30 quails (6 birds/pen) from each feeding treatment (chosen on the basis of pen average final body weight) (3 female and 3 male) per pen were weighed and slaughtered for carcass analysis. Carcass, liver, heart, proventriculus, gizzard, intestine, spleen, bursa of fabricius and sex organs for each slaughtered bird were determined and calculated as a relative percentage of live body weight. All measurements were performed on the pen basis using a high precision electronic scale. The resulting samples of carcass were stocked at -20ºC for genetic analyses.
Genetic analysis
Twelve samples of dram muscle tissues were collected from slaughtered birds at the end of the experimental period (6 weeks) from each treatment were analyzed and gene of HSP70 expression by Animal Genetic Resources Department, National Gene Bank, Agricultural Research Center, Giza, Egypt, the samples were collected from the Poultry Research Farm of the Biological Application Department, Nuclear Research Center, Egyptian Atomic Energy Authority.
Rna Isolation
RNA extraction from tissue samples was applied using QIAamp RNeasy Mini kit (Qiagen, Germany, GmbH) when 30 mg of the tissue sample was added to 600 µl RLT buffer containing 10 µl β-mercaptoethanol per 1 ml. For homogenization of samples, tubes were placed into the adaptor sets, which are fixed into the clamps of the Qiagen Tissue Lyse. Disruption was performed in 2 minutes high-speed (30 Hz) shaking step. One volume of 70% ethanol was added to the cleared lysate, and the steps were completed according to the purification of total RNA from animal tissues protocol of the QIAamp RNeasy Mini kit (Qiagen, Germany, GmbH). N.B. On column DNase digestion was done to remove residual DNA.
Oligonucleotide Primers
Primers used were supplied from Metabion (Germany) are listed and PCR conditions as shown in table (2) lists the primer sequences that were used in the real-time qRT-PCR analysis.
Table 2
Target and reference genes, primers sequences, cycling conditions for SYBR green RT-PCR and reference.
genes | Primers sequences | R.T. | P.D. | Amplification (40 cycles) | Dissociation curve (1 cycle) | Reference |
Secondary denaturation | Annealing (Opticson) | Extension | Secondary denaturation | Annealing | Final denaturation |
Target gene (Hsp70) | AACCGCACCACACCCAGCTATG | 50˚C 30 min. | 94˚C 15 min. | 94˚C 15 sec. | 65˚C 30 sec. | 72˚C 30 sec. | 94˚C 1 min. | 65˚C 30 sec. | 94˚C 1 min. | Ebrahimi et al. 2015 |
CTGGGAGTCGTTGAAGTAAGCG |
Reference gene (ß. Actin) | CCACCGCAAATGCTTCTAAAC | 51˚C 30 sec. | 51˚C 30 sec. | Yuan et al. 2006 |
AAGACTGCTGCTGACACCTTC |
RT: Reverse transcription P.D: Primary denaturation |
SYBR green RT-PCR
Primers were utilized in a 25µl reaction containing 12.5 µl of the2x QuantiTect SYBR Green PCR Master Mix (Qiagen, Germany, GmbH), 0.25 µl of RevertAid Reverse Transcriptase (200 U/µL) (Thermo Fisher), 0.5 µl of each primer 20 pmol concentration, 8.25 µl of water, and 3 µl of RNA template. The reaction was performed in a Strata gene MX3005P real-time PCR machine. The sample was compared with that of the positive control group according to the "ΔΔCt” method stated by Yuan et al. (2006) using the following ratio: (2-ΔΔct) whereas ΔΔCt = ΔCt reference – ΔCt target; ΔCt target = Ct control –Ct treatment and, ΔCt reference = Ct control- Ct treatment
Expression HSP70 gene
SYBR intercalating dye was used to analyze mRNA level expression. Real-time PCR was carried out for Hsp70 and housekeeping gene (ß. Actin).Two genes of ß. Actin and HSP70 gene was expressed with treatments 50, 100% replacement of the soybean meal with H. illucens meal and control either exposed or non-exposed to high ambient temperatures as shown in (Table 5 and Figs. 1 and 2).
Statistical analysis
Data of this study for all variables were statistically subjected to ANOVA as a completely randomized design using SAS (2012), software version 9.1.3. Differences among means were assessed using Duncan’s multiple range tests (Duncan 1955). The statistical model used in the analysis was as follows: Yijk = µ + Oi + Dj + Ag + ODij + ODAijg + eijk, where Yijk = the observation mean; µ = the overall mean; Oi = the effect of ith dietary treatment; Dj = the effect of jth heat stress; Ag = the effect of gth sex; ODij = the interaction effect of dietary treatments with heat stress; ODAijg = the interaction effect of dietary treatments and heat stress with sex; and eijk = the residual error of the model.
For the genetic study, a one-way analysis of variance was done using SAS (2012) software version 9.1.3, following the General Linear Model procedure with dietary treatment as fixed effects. Mean values assessed for significance using (Duncan, 1955) multiple range tests. Finally, analysis of the SYBR green RT-PCR results amplification curves and CT values were determined by the strata gene MX3005P software. To estimate the variation of gene expression on the RNA of the different samples, the CT of each.