Chemicals
SA and BHT are commercially available and Tyr020 has been synthesized according to Krug et al.(2018). Krug et al. published this compound under the name compound 8a (Krug et al. 2018)
LED module
The LED module is custom-made by Lumitronix® and consists of 48 individual dimmable LEDs (Figure 1). The plate can be mounted underneath a transluminescent-bottomed 48-well MTP resulting in one LED beneath each well. To allow a light gradient within the plate, each LED is individually adjustable. Optical isolators prevent stray light from LEDs into neighboring wells. A black microtiter platebody needs to be used to eliminate stray light between wells.
Determination of the OTR using µRAMOS device
The OTR was determined using RAMOS (Anderlei et al. 2001, Anderlei et al. 2004) for MTPs (µRAMOS), which was developed and built in house (Flitsch et al. 2016, Schilling et al. 2015). Measurements were performed using black, clear bottom microtiter plates. The µRAMOS device was mounted on top of the MTP. The measurement was performed at 20°C with a shaking frequency of 600 rpm and a shaking diameter of 3 mm. The filling volume was 1.6 mL per well.
A. thaliana growth
A. thaliana (accession Col-0) seeds were washed in 70% (v/v) ethanol for 30 min and then twice in 100% (v/v) ethanol for 1 min, according to Figure 2. Dried seeds were transferred to a MTP using a seed dispenser to a number of 15 ± 5 seeds per well. The seeds were provided with 1.5 mL (MS) medium. MS medium, including vitamins (M0222; Duchefa Biochemie B.V.) was prepared as recommended by the manufacturer and supplemented with 2.5 g/L sucrose. The pH value was adjusted to 5.7 using 0.01 M potassium hydroxide, before the medium was autoclaved (121°C, 20 min).
For stratification the seed-loaded MTPs were stored at 4 °C overnight to ensure synchronous and efficient germination. On the next days, the plates were cultivated on the LED module at 20 °C. After 3 weeks the µRAMOS device was mounted atop.
Cultivation, priming and elicitation of soil-grown A. thaliana seedlings
A. thaliana seedlings were grown on soil with a 16 h day/ 8 h night cycle applied in a pests-free room. When needed, the soil was irrigated. After 4 - 6 weeks, seedlings were used for conventional priming experiments. The leaves of A. thaliana seedlings were sprayed with Tyr020 dilutions in ascending concentrations between 1 µM and 100 µM. As positive control, the leaves of another plant seedling were sprayed with 100 µM BTH. As negative control leaves of plant seedlings were sprayed with 21 % (w/v) wettable powder in water. Every condition was applied on six plant seedlings each. The plant seedlings were further grown for 48 h, before three plants of each condition were infiltrated with 1 nM flg22 solution.
Determination of WRKY6, WRKY53 and Actin2 expression
Five hours after elicitation, leaves were harvested and homogenized. RNA was isolated from frozen leaves using the TRIZOL method, as published by Chomczynski, 1993. The RT-qPCR reactions were performed in a 10 µL volume. The PCR mixture was consisting of 2.7 µL nuclease free water, 5 µl Takyon TM No Rox SYBR MasterMix dTTP Blue (Eurogentec), 0.15 µL forward primer, 0.15 µL reverse primer, and 2.5 µL template. The according primers are listed in Table 1. The amplification was performed using a PCR machine (Applied Biosystems). The PCR was performed for 3 min at 95°C as initial denaturation, followed by 40 cycles of 15 sec at 95 °C for denaturation, 60 sec at 60°C as annealing, 15 sec at 95°C for extension. The final extension was set to 60°C for 1 min.
Table 1: Primers used for RT-qPCR.
Primer
|
Sequence 5´-3´
|
WRKY6
|
ACTTCACGGTCATTATCTCCAGC
TGAATTTAGGTTTCCGGTGAGTC
|
WRKY53
|
CTCCATCGGCAAACTCTTCAC
CCGAGCGTACAACTTATTCCG
|
Actin2
|
GGTAACATTGTGCTCAGTGGTGG
GGTGCAACGACCTTAATCTTCAT
|
SDS-PAGE, western-blotting analysis and immunodetection
To detect MPK phosphorylation sites, leaves of the soil-grown seedlings were harvested and homogenized at 5 h after elicitation. Frozen tissue was either ground using the Precellys 24 homogenizer (Bertin Instruments). All tubes and buffers were kept cold during the procedure. Ground plant material was washed twice with 100 % acetone and centrifuged at
16,100 g at 4 °C for 5 min. The pellet was resuspended in 10 % (w/v) TCA in acetone and were transferred to an ultrasound ice-water bath for 10 min followed by another centrifugation step (16,100 g, 4 °C, 5 min). Then, the pellet was washed once with 10 % (w/v) TCA in acetone, once with 10 % TCA (w/v) and once with 80 % (v/v) acetone. The supernatant was discarded and the pellet was resuspended at RT in freshly prepared dense SDS buffer (100 mM Tris-HCl pH 8.0, 30 % (w/v) sucrose, 2 % (w/v) SDS, 5 % (v/v) β-mercaptoethanol). An equal volume of phenol/Tris-HCl pH 8.0 (Applichem) was added to each tube. Samples were centrifuged at 16,100 g at RT for 20 min. The upper phase of each tube was split into two new tubes, 5 volumes of 100 mM ammonium acetate in methanol were added and total protein was precipitated at -20 °C for 60 min. Proteins were collected by centrifugation at 16,100 g at 4 °C for 5 min. Pellets were washed once with 100 mM ammonium acetate in methanol and once with 80 % (v/v) acetone and the pellets were dried. To determine total protein concentration, pellets were resuspended in buffer (7.7 M urea, 2 M thiourea, 300 mM NaCl, 0.25 % (w/v) CHAPS, 50 mM NaH2PO4 pH 8, 50 mM Tris pH 8, 20 mM imidazole) and incubated at RT for 1 h before Bradford protein assay (Quick-Start Bradford; BioRad) was performed. Protein samples were resuspended in loading buffer (10X Sample Reducing Agent, 4X LDS Sample Buffer; NuPAGE) to equal concentrations and heated at 95 °C for 10 min. The denatured samples were applied to a two parted polyacrylamide gel, consisting of a 4% collection gel and a 12% separation gel. The pockets were loaded with 5 µL sample and gel electrophoresis was performed at 175 V for 60 min. MES, pH 7.3, was used as running buffer.
For the subsequent western blot, the proteins were electrophoretically transferred from the SDS gel to a nitrocellulosemembrane (Carl Roth) applying 60 min at 250 mA. After blotting, the membrane was washed 2 times for 5 min each in TBST buffer (20 mM tris; 150 mM NaCl; 0.1 % (v/v) Tween 20). The blocking was performed for 60 min in a 5% (w/v) skimmed milk powder (Nutricia Protifar ) in TBST buffer solution. After blocking, the membrane was washed 2 times for 5 min each in TBST buffer. The primary antibody anti p44/42 (Cell SignalingTechnologyR) was diluted 1:1000 in a 5% (w/v) Bovine Serum Albumin (Panreac AppliChem) in TBST buffer solution. The membrane was incubated for 12 h at 10 °C. After incubation, the membrane was washed twice for 5 min in TBST buffer.
As secondary antibody, the anti rabbit IgG, HRP-linked Antibody #7074 (Cell SignalingTechnologyR) was applied. It was diluted 1:2000 in a solution of 5 % (w/v) skimmed milk powder in TBST buffer solution. The membrane was incubated for 1 h at room temperature in the solution, before being washed twice in TBST for each 5 minutes.
For protein detection, the ChemiDocTMMP Imagine System (BioRadR) with white light irradiation was used.
Ponceau staining
To check for equal protein loading the membrane was stained with Ponceau S. For staining the Ponceau S Solution (Panreac AppliChem) was used, and the producer’s protocol was followed precisely.
Determining A. thaliana susceptibility to Hyaloperonospora arabidopsidis (Hpa)
A. thaliana Col-0 plants were grown in short day (8 h light of 120 µmol/m2/s1, 22 °C, 65% relative humidity). Two-week-old plants were sprayed with wettable powder (WP) (control) or a WP formulation of Tyr020 (final concentration 25 µM). 24 h after treatment, plants were inoculated by spraying with a conidiospore suspension of Hpa (race Noco; 4 x 104 spores per mL of water). Inoculated plants were covered with a transparent lid to ensure high humidity and kept in short day condition. After 7 d, the number of spores released by Hpa was determined as described by Schmitz et al. (2010).