Animals
Three- and seven-month-old 5×FAD mice overexpressing K670N/M671L (Swedish), I716V (Florida), and V717I (London) mutations in human APP (695), as well as M146L and L286V mutations in human PS1 (41), were provided by C. Zhang (Peking University, Beijing, China). Genotypes were confirmed by PCR analysis of toe biopsy specimens. Negative mice in the same litter were used as the wild-type controls. Mice were housed four to five per cage with a 12-h light/12-h dark cycle, with food and water ad libitum. Male mice (C56BL/6J background) were used in all experiments to avoid the influence of sex. All experimental animal procedures were approved by the Institutional Animal Care and Use Committee of the National Beijing Center for Drug Safety Evaluation and Research, State Key Laboratory of Medical Countermeasures and Toxicology, Institute of Pharmacology and Toxicology.
The experimental groups were as follows: the young mice were randomly divided into four groups with ten mice per group, namely the wild-type sham (Young-WT-Sham), wild-type exposure group (Young-WT-2 W/kg), the AD sham (Young-AD-Sham), and the AD sham exposure group (Young-AD-2 W/kg). The old mice were randomly divided into three groups with eight mice in each group, namely Old-AD-Sham, Old-AD-2 W/kg, and Old-AD-4 W/kg.
Electromagnetic fields exposure system and dosimetry
The electromagnetic field exposure system was mainly composed of a signal generator, an amplifier, a control PC, and a reverberation chamber (dimension: 1.5 × 1.5 × 1.5 m3), which was equipped with a transmitting antenna on each of its walls (six dipole antennae in total). A one-in-six-out power switcher connected the output port of the amplifier and the input ports of the six antennae. The selection of the emission antennae was enabled by the control PC. In such a case, only one antenna emitted at one time and the six antennae randomly functioned, but each of them had an equal possibility to transmit the signal. The configuration ensured that the wave came from all directions in a temporal view. One two-level plastic stand was placed in the middle of the reverberation chamber, which supported the plastic containers. To avoid electromagnetic wave reflection by the adjacent mouse in the same container, only one mouse was placed in each container. A schematic of the exposure system is shown in Fig. 1.
The system is composed of a signal generator, an amplifier, a control PC (a) and a reverberation chamber with a dimension of 1.5 × 1.5 × 1.5 m3 (b). One two-level plastic stand was placed in the middle of the reverberation chamber (c), which supports plastic containers for exposure of mice.
A measurement-simulation strategy was applied to determine the whole-body specific absorption rate (SAR) [12]. In brief, the E-field strength at different points in the container was measured along with the alternative emissions of the six antennae. The overall E-field results were then averaged over the values obtained at various locations. The measurement was performed with the sham mouse models filled with tissue equivalent liquid, simulating the power absorption of the mice in the real experiment. Consequently, the measured overall E-field strength was applied in a finite-difference time-domain solver (Sim4life, Speag AG, Zurich, Switzerland) to calculate the power distribution in the voxelized mouse model. The details can be found in the literature[13]. To specify, the measured field homogeneity in the volume holding the containers was superior to 0.8 dB.
The reverberation chamber was placed in a ventilation-, humidity-, and temperature-controlled environment suitable for animal. The mice were exposed to 1500 MHz continuous electromagnetic signals for 2 h/day, 5 days/week, for 5 months. For 3-month-old young mice, the SAR was 2 W/kg, and for 7-month-old mice, the SARs were 2 W/kg and 4 W/kg. Mice in the sham-exposure group were treated in the same way with microwave off. Behavioral tests were started at 16 days before the end of microwave exposure, and tissue preparation was immediately conducted after exposure.
Behavioral tests
Morris water maze (MWM) The MWM was used to assess spatial learning and memory ability, which mainly contained a circular pool (120-cm diameter and 30-cm height) filled with water which was maintained at 16-18°C and made opaque using titanium dioxide[14]. During the visible platform training period, the escape platform (10-cm diameter) was placed at the center of a designated quadrant of the pool with its top positioned 1 cm below the water surface, and the platform was marked by a red flag. The mice were trained three times to have their swimming, vision, and muscle tone evaluated for normality. Subsequently, mice that could not swim and those that were abnormal were removed from the trial. After visible platform training, the mice were subjected to hidden platform training with three trials per day for six consecutive days. The spatial exploration test was conducted on the eighth day after platform removal. The times of crossing the platform and swimming time in the quadrant of the platform were recorded.
Y-Maze The Y-maze consisted of three arms with the same length and angle between the two neighboring arms, which was used to measure working and reference memories. In the working memory test, the three arms of the Y-maze were open. The activity of the mice was recorded for 5 min, and the frequency of alternating of mice in the three arms was counted. The reference memory experiment was conducted 3 days after the end of the working memory. First, any one of the three arms was closed. Furthermore, the mouse was allowed to move freely in both arms for 5 min, and their activities were recorded. One hour later, one of the two open arms in the above experiment and the closed arm in the current experiment were simultaneously closed and opened, respectively. The mouse was allowed to explore for 5 min to calculate the time and distance in the new open arm in relation to the evaluation of the reference memory.
Open field test (OFT) The OFT was used to study the autonomous behavior of mice in a new environment. The mice were placed in a square box with a length, width, and height of 50, 50, and 20 cm, respectively. The area at the center with an edge of 10 cm in length was defined as the central area, and the activity of mice in the box was recorded for 5 min. The number of times the mice entered the central area delineated in the open field and the total time spent in this area were counted to evaluate the anxiety of the mice.
Elevated plus maze (EPM) The EPM, which consisted of two open and two closed arms, was used to evaluate the anxiety-like state of the mice. The mouse was placed at the center of the two closed arms, and the mouse was allowed to explore freely for 5 min. Furthermore, the residence time and movement distance of the mice were measured in the closed and open arms, respectively.
Tissue preparation
The mice were anesthetized with 0.7% pentobarbital sodium and euthanized after the behavioral tests and electromagnetic field exposure. Consequently, the mice in each group were divided into two parts, brain tissues were then harvested, half of the mice were used for pathological observation, and the other half was used for biochemical detection. For histological analysis, the tissues were fixed in 4% paraformaldehyde solution. For molecular biological analysis, the tissues were stored at -80°C.
Enzyme-linked immunospecificassay (ELISA)
Brain tissues were collected from mice and prepared into homogenates, which were snap-frozen on dry ice and then stored at -80°C for ELISA analysis. ELISA was performed to measure Aβ levels in the mouse hippocampus and cortex; Aβ 40 and 42 peptides were quantified using commercial ELISA kits (Invitrogen, Carlsbad, CA; KHB3481 and KHB3441, respectively) following the manufacturer’s protocol. Briefly, samples were diluted in a sample diluent to detect Aβ 40 and Aβ 42 levels within the optimal working range of each standard at known concentrations (0-500 pg/mL). After the samples were incubated with antibody solutions, the concentration of proteins in the sample was determined by colorimetric assay via absorbance at 620 nm (A620). The A620 values were converted to pg Aβ 40 or pg Aβ 42/mg protein by correcting for dilution factors. The Aβ 42 and Aβ 40 levels per group were averaged and expressed as the mean ± standard error (SE).
qPCR
Total RNA in the mouse hippocampus was extracted using TRIzol reagent and reverse transcribed into cDNA. The corresponding primers were designed and synthesized by Shenggong Bioengineering Co., Ltd. (Table 1). Quantitative PCR was performed according to the instructions of the GoTaq®qPCR Master Mix reagent (Promega). The equipment used was 7500 real-time fluorescent quantitative PCR instrument (Applied Biosystems). The Ct values of the target genes in each sample were collected. The relative quantitative method was used to calculate the ΔCt value of each sample, and the relative expression of the target gene in each sample was analyzed.
Table 1 Primers used for qRT-PCR
Genes
|
Forward
|
Reverse
|
GAPDH
|
5’AGGTCGGTGTGAACGGATTTG3’
|
5’GGGGTCGTTGATGGCAACA3’
|
BACE1
|
5’GGCGGGAGTGGTATTATGAAGTGA3’
|
5’GAAGGATGGTGATGCGGAAGG3’
|
IL-4
|
5’GGTCTCAACCCCCAGCTAGT3’
|
5’GCCGATGATCTCTCTCAAGTGAT3’
|
IL-6
|
5’GCTACCAAACTGGATATAATCAGGA3’
|
5’CCAGGTAGCTATGGTACTCCAGAA3’
|
IL-10
|
5’GCTCTTACTGACTGGCATGAG3’
|
5’CGCAGCTCTAGGAGCATGTG3’
|
Frozen section
After the brain tissues were fixed in paraformaldehyde, it was dehydrated with 10% sucrose once, 20% sucrose once, and 30% sucrose twice. Subsequently, samples were sectioned into 40μm-thick slices, placed in antifreeze, and stored at -20°C.
Immunohistochemistry
Brain slices (40μm) from the frozen sections were immunoassayed with mouse anti-Aβ primary antibody (Biolegend Co.) and rabbit anti-Iba1 primary antibody (Wako. Co.). The donkey anti-mouse green fluorescent antibody and anti-rabbit red fluorescent secondary antibodies (Jackson Immuno Research Co.) were diluted (1:400) and incubated with brain slices in the absence of light following the manufacturer’s protocol. Hoechst (Thermo Fisher Co.) was prepared in 1×PBS (1:1000) for nuclear staining. The appropriate visual field was selected using a laser confocal microscope (Olympus Co.). Photographs were subsequently analyzed using Image-J software. Aβ protein was stained with green fluorescence, and microglia (Iba1) were stained with red fluorescence. Pictures of the CA1 and DG regions in the hippocampus were then taken. The number of Aβ plaques in the CA1 and DG regions (number of green fluorescent plaques) was counted. Image-J was used to analyze the optical density of the red fluorescence and calculate the average optical density in the corresponding brain area.
Statistical analysis
The values are expressed as the mean ± standard error (mean ± SE). One-way ANOVA was used to analyze the significant differences between the groups. Data were statistically analyzed separately for young and old mice. The normal distribution of the samples and equal variances were tested. When the p value of F-TEST was >0.05, the equal variance hypothesis LSD test was applied; otherwise, the heteroscedasticity hypothesis Tamhane’s T2(M) test was used. For data repeatedly acquired at different times such as the MWM test and body weights, a two-way ANOVA was used to analyze significant differences between the groups. A value of p<0.05, indicated a significant difference, and p<0.01 indicated a very significant difference.