Animals. 6 to 8-week-old female BALB/c mice weighing 15–20g were purchased from the Experimental Animal Center of Shanghai, Chinese Academy of Sciences. All mice were maintained under specific pathogen free (SPF) conditions with a 12-hour light/dark cycle.The study was conducted in accordance with internationally accepted principles for the use and care of laboratory animals and was approved by the Ethics Committee of Zhejiang University of Traditional Chinese Medicine (approval number: scxk − 2018-0006; Hangzhou, China).
Drugs and Reagents. Triptolide of 98% purity, as verified by HPLC (Sigma, St. Louis, MO, USA), was dissolved in dimethyl sulfoxide (DMSO) at a stock concentration of 20mg/ml. Naïve CD4+ T cell Isolation Kit II was purchased from Miltenyi Biotec (Bergisch Gladbach, Germany). LEAF™-purified anti-human CD3 and CD28 antibodies were purchased from BioLegend (San Diego, CA). FITC-conjugated anti-mouse CD4, PE-conjugated anti-mouse CD25, PE-conjugated anti-mouse FOXP3 antibodies and PE-conjugated anti-mouse IL-17A antibodies were purchased from Invitrogen eBioscience (Avenue Waltham, MA, USA). Anti-AKT, anti-pAKT (Ser473), anti-mTOR, anti-pmTOR (Ser2448), anti-P70S6K, and anti-pP70S6K (Thr389) antibodies were purchased from Cell Signaling Technologies (Danvers, MA, USA). Prednisolone acetate tablets were purchased from Shanghai Xinyi Pharmaceutical Co., Ltd., and Imiquimod (IMQ) (5%) cream from Hubei Keyi Pharmaceutical Co., Ltd.
Grouping and Treatment. Eight mice were selected at random as the control group. The remaining 48 mice were the triptolide group, induced with IMQ to be lupus-like autoimmune disease models and then treated with triptolide. For the triptolide group mice, 1.25mg of 5% IMQ cream were applied topically to the skin on the right ears of the mice 3 times per week for 8 weeks. Two weeks later after modeling, the 48 mice were randomized into six groups (8 mice per group): model group, low-dose treatment group (triptolide 0.1mg/kg/d), mid-dose treatment group (triptolide 0.2mg/kg/d), high-dose treatment group (triptolide 0.3mg/kg/d), prednisone treatment group (prednisone 5mg/kg/d), and rapamycin treatment group (rapamycin 100mg/kg/d). The model group and control group were treated with 0.9% saline 0.4ml/d by oral administration. Animals were sacrificed after 6 weeks of administration.
Measurement of urinary protein and serum chemistries. After model establishment, naïve contents of urinary protein were measured using random urine samples at 8–10 a.m. of the 0, 3rd and 6th week. All mice were free to access water but forbidden to access food during the period of sample collection. Urinary protein was evaluated by Coomassie brilliant blue staining. Blood samples were collected after the last administration and then the mice were sacrificed. The spleens were weighed. The kidneys were removed following sacrifice and fixed in 5% buffered formalin. Serum was isolated by centrifugation for 15 min at 4°C (3500 rpm). The blood samples of mice were collected for the analysis of liver function and kidney function. The levels of TGF-β, IL-17A, anti-dsDNA antibody (IgG) and smith antibody concentration in each group were evaluated by enzyme-linked immunosorbent assay (ELISA).
Histopathologic assessment. The renal tissues were dehydrated through a series of graded alcohol and embedded in paraffin. Paraffin-embedded kidney sections (3µm-thick) were stained with hematoxylin-eosin (H&E) and periodic acid-schiff stain (PAS). Glomerular lesions were graded semiquantitatively on a scale of 0–2, including mesangioproliferation, endocapillary proliferation, mesangial matrix expansion and segmental sclerosis (0 = 10%; 1 = 10–50%; 2 ≥ 50% of the glomeruli examined). Global glomerular lesion scores were evaluated under 400× light microscope fields 50 glomeruli at least and renal tubular damage was evaluated under 400× light microscope fields.
Immunofluorescence. Immunofluorescence staining was carried out on frozen sections embedded in cryo-embedding media (OCT compound). Renal tissues were sectioned at 5 µm using freezing microtome, stained with 1:100 diluted rabbit anti-mouse IgG antibody (Proteintech Group, Wuhan, China) at 4°C overnight and incubated with FITC or CyTM3-conjugated goat anti-rabbit IgG (Proteintech Group, Wuhan, China). These sections finally were mounted by DAPI-Fluoromount-G clear mounting agents and examined under an inverted microscope with 8 micrographs per slice obtained randomly (magnification 400×). The fluorescence signal was quantified using image-processing software (Image J 1.47), with six sections per group. The data were presented as average density (per pixel) (average density = integrated density/area).
Cell isolation and sorting. Splenocyte were isolated from the spleen of female BALB/c mice at 8 weeks old. Mononuclear cells were prepared by Ficoll-Hypaque density gradient centrifugation after passing through a 70 µm pore mesh. Cells obtained from the gradient interface were washed twice in PBS, and immediately separated naïveive CD4+ T Cell Isolation Kit (Miltenyi Biotec, Bergisch Gladbach, Germany).
T cells culture and stimulation. The isolated CD4+CD25−T cells were cultured in 96-well at a concentration of 1x105 cells/well. Cells were stimulated with 2 µg/ml anti-CD3 (clone 145-2C11; BD Biosciences) and 2 µg/ml anti-CD28 (clone 37.51; BD Biosciences). For Th17 cell induction, cells were cultured with 2.5 ng/ml transforming growth factor β-1 (TGF-β1) (R&D systems), 20 ng/ml interleukin 6 (IL-6) (R&D systems), 10 µg/ml anti-IL-4 (Pepro Tech) and 10 µg/ml anti-IFN-γ (Biolegend). For Treg cell induction, cells were cultured with TGF-β1 (2.5 ng/ml; R&D systems) and interleukin 2 (IL-2) (10 ng/ml; BD Biosciences). The culture medium consisted of RPMI 1640 (Gibco) supplemented with 10% fetal calf serum (Hyclone), 1 mM sodium pyruvate (Sigma-Aldrich), 50 µM β-mercaptoethanol (Sigma-Aldrich), 0.1 mM non-essential amino acids (Sigma-Aldrich), 100 U/ml penicillin, 2 mM L-glutamine, 100 mg/ml streptomycin and 10 mM Hepes. Cells were harvested after 48 hours for further analysis.
Cell viability measurements. Th17 and Treg cells were induced in 96-well plates at 1.0 × 105/well and then treated with vehicle, rapamycin or triptolide (0-80nM) for 72 hours. The cell viability was evaluated respectively by cell counting kit-8 (CCK-8) assay (KeyGEN, BioTECH, China).
In vitro grouping and administration. Purified CD4+CD25−T cells were cultured in 96-well plates and stimulated with anti-CD3/CD28 for 72 hours. The optimal concentrations of triptolide on Thl7 and Treg cells detected by CCK-8 experiment were 2.5nM, 5nM and 10nM, which were selected as the following experimental concentrations for Th17 and Treg cells. The rapamycin group (100 nM) was considered as positive control. Cultured cells were harvested after 5 days and analyzed by flow cytometry.
Enzyme-Linked Immunosorbent Assay. The levels of TGF-β1 secreted by iTreg cells and IL-17 by Th17 cells were evaluated in splenic supernatants using TGF-β1 and IL-17 mouse ELISA (Wuhan Huamei Bioengineering Co., Ltd).
Flow cytometry analysis. As for Th17 cell percentage analysis (CD4+IL17A+T cells/CD4+T cells %), prepared mononuclear cells were first stimulated by 25ng/ml phorbol myristate acetate (PMA, Sigma-Aldrich) and 1 µg/ml ionomycin (Sigma-Aldrich) in the presence of 2 mmol/ml monensin (Sigma-Aldrich) for 4 hours. Next, mononuclear cells were stained with FITC-conjugated CD4 antibody at 4℃ in the dark for 30 minutes. Then, cells were fixed, permeabilized, and stained intracellularly with PE-conjugated IL-17A antibody (eBioscience company). For Treg cell percentage analysis (CD4+CD25+Foxp3+T cells/CD4+T cells %), mononuclear cells were stained with FITC-conjugated CD4 antibody for 30 minutes, and intracellularly stained with APC-conjugated CD25 antibody (eBioscience company) and PE-conjugated Foxp3 antibody (eBioscience company) respectively for 45 minutes. Flow cytometric analysis was performed on a FACScanto flow cytometer (BD Biosciences company, San Jose, CA, USA). Experiments were performed in triplicate. Isotype controls were used to correct nonspecific binding in all procedures.
Quantitative reverse transcription–polymerase chain reaction (PCR). RORγt and Foxp3 mRNA were determined by Reverse Transcription-Quantitative PCR (RT-qPCR). Total RNA was isolated from splenocytes using the MiniBEST Universal RNA Extraction kit (Takara Bio, Inc., Japan). RNA reverse transcription was carried out by using PrimeScript RT Master Mix (Takara Bio, Inc., Japan). The reactions were performed by CFX96 (Bio-Rad Laboratories, Inc., USA). The primer sequence of each target mRNA is as follows: 5’-ACGGCCCTGGTCT-CATCA-3’ and 5’-CCAAATGTATGCAGATGTCCAC-3’ for RORγt; 5'-AGTTCCTTCCCAGAGTTCTTCCA-3' and 5'-GCTCAGGTTGTGGCGGATG-3' for Foxp3; 5’- ACCGCACTCCCTCTCTCGTAT-3’ and 5’- TGGCGTGAGGGAGAGCATAG − 3’ for β-actin. 2−ΔΔCq method was used to quantify the relative mRNA expression.
Western blotting Total protein was extracted from the cultured cells and blotted onto PVDF membranes, which were then blocked in TBST containing 5% skimmed milk for 1 hour. The membranes were incubated with antibodies against AKT, p-AKT, mTOR, p-mTOR, P70S6K, p-P70S6K, and GAPDH (1:1000, all from CST, Beverly, MA) at 4℃ overnight. On the second day, the membranes were incubated with biotinylated goat anti-rabbit IgG or goat anti-mouse IgG (1:2000, CST, Beverly, MA) for 2 hours at room temperature. The signals were visualized by ECL Advance reagent (Millipore, Billerica, MA) and the specific protein bands were quantified using ImageLab software.
Statistical analysis
All data were expressed as Mean ± SD. Differences between groups were analyzed by independent-samples t-tests and one-way analysis of variance using SPSS 17.0 software. P < 0.05 was considered statistially signiicant.