Study samples: Tissues of uterine leiomyomas and corresponding normal myometrium were collected from 32 women with symptomatic leiomyomas, who underwent operations at West China Second University Hospital (Chengdu, P.R. China), and were stored in liquid nitrogen immediately after surgeries. Written informed consents were obtained from all patients, and the Institutional Review Board of West China Second University Hospital approved the study protocol. During tissue collection, eligible subjects and tissue specimens were defined as: 1) no GnRH-a or oral contraception used before surgery; 2) pathological diagnosis of leiomyoma; 3) no accompanying adenomyosis or endometriosis; 4) minimum number of leiomyomas involved in multiple leiomyomas was 5; and 5) leiomyomas intraoperatively revealed as multiple leiomyomas fused as one were excluded from solitary leiomyoma group. 6) SL was defined as one leiomyomas identified by both ultrasound and surgery findings. And the diameter of SL should be larger than 8cm.
MiRNA microarray analysis: MiRNA microarray analysis was performed on three pairs of solitary leiomyoma and corresponding myometrium, and three pairs of multiple leiomyomas and corresponding myometrium. The frozen tissues were cryopulverised to fine powder with the BioPulverizer (BioSpe, America). The powdered tissue was homogenised with TRIzol Reagent (Invitrogen) using the Mini-beater-16 (BioSpec), and total RNA was purified using the RNeasy Mini Kit (Qiagen). The quality of the total RNA was verified by spectrophotometry using NanoDropND-1000 (ND-1000, Nanodrop Technologies). The integrity of RNA was evaluated by denaturing agarose gel electrophoresis. RNA labelling and array hybridisation was performed according to the manufacturer’s protocol (Exiqon). Total RNA (1μg) was labelled with Hy5 fluorescent and Hy3 fluorescent probes using the miRCURY Array Power Labeling kit (Exiqon). The miRCURY LNA Array version 7th generation (Exiqon) was used to hybridise the labelled RNA. Subsequently, the hybridised slides were scanned using the Axon GenePix 4000B microarray scanner (Axon), and image reading was performed using GenePix pro V6.0 (Axon).
Microarray analysis: With a cut-off fold-change (FC) value of 2, miRNAs expression profiles of each SL and ML compared to the corresponding myometrium of solitary leiomyomas (MSL) and myometrium of multiple leiomyomas (MML), respectively, were yielded. Dysregulated miRNAs of three pairs of SL vs. MSL and three pairs of ML vs. MML were filtered by taking intersection within groups. We further took intersections between up-regulated miRNAs in SL vs. MSL and up-regulated miRNAs in at least two pairs of ML vs. MML. The yielded miRNAs were considered not differentially expressed and excluded. Similarly, SL vs. MSL down-regulated, ML vs. MML up-regulated, and ML vs. MML down-regulated miRNAs were filtered by the same strategy. The remaining miRNAs were considered to be potentially dysregulated between SL vs. MSL and ML vs. MML. The validated functional information of each miRNA was conducted using miRTarBase 6.0 (updated to September 2015). To collect validated functional information published after September 2015, we further carried out a comprehensive online search of published studies in PubMed (US National Library of Medicine, National Institute of Health; http://www.ncbi.nlm.nih.gov/pubmed/). Publications were identified with the use of the following search strategies: microRNA [Title/Abstract]. For the same searching purpose, gene targets of validated differentially expressed miRNAs in this study were identified using the same search methodology in PubMed. Candidate miRNAs were rated in four aspects: 1) The false discovery rate (FDR): 3 points for FDR < 0.05, 2 for 0.05 < FDR < 0.1, and 1 for FDR > 0.1; 2) expression condition in another group: 3 points for contrarily regulated in 2 pairs of leiomyoma vs. myometrium in another group, 2 for contrarily regulated in 1 pair of leiomyoma vs. myometrium in another group, 1 for not found dysregulated in another group, and -2 for regulated in same way in 1 pair of leiomyoma vs. myometrium in another group; 3) expression level (normalised signal intensity (NSI)): 3 points for NSI > 5, 2 for 5 > NSI > 1 and 1 for NSI < 1. 4. Validated function potentially related to leiomyoma genesis (Wnt signalling/fibrogenesis/TGF/hormone synthesis or metabolism[26, 27]): 3 points for 3 items, 2 for 2 items, 1 for 1 item, and 0 for no relative research.
MiRNA gene targets prediction and pathway analysis: Target gene prediction of miRNAs (miR-142-3p, miR-146b-5p, miR-146a-5p, miR-136-3p, and miR-608) was conducted using intersections of results yielded from four miRNA target prediction databases (miRWalk 2.0, miRanda, TargetScan, and RNA22). Yielded genes were uploaded to the Database for Annotation, Visualization and Integrated Discovery (DAVID) v6.8 to perform functional annotation clustering analysis. Signalling pathway enrichment was carried out based on KEGG PATHWAY and Benjamini-Hochberg modified P-value was yielded. We further searched miRTarBase 7.0 (updated September 2017) and PubMed for validated functional information of miR-142-3p.
Quantitative RT-PCR: Quantitative RT-PCR (qRT-PCR) was performed on 13 pairs of SL and MSL and 19 pairs of ML and MML to quantify miRNAs (miR-142-3p, miR-146b-5p, miR-146a-5p, miR-136-3p, and miR-608). Further, 10 pairs of SL and MSL and 10 pairs of ML and MML (all included in those tissues used for miRNA quantification) were measured to quantify gene transcripts (CTNNB1, APC, and AXIN2). Total RNA was extracted from leiomyomas and myometrium tissues using the miRNeasy Mini Kit (Qiagen) according to the manufacturer’s instructions. Quality of the yielded RNA was verified using a NanoDropND-1000 (ND-1000, Nanodrop Technologies), and the integrity was evaluated by agarose gel electrophoresis. Reverse transcription (RT) to complementary DNA (cDNA) was conducted using the miScript II RT Kit with miScript HiSpec Buffer (Qiagen) on the GeneAmp® PCR System 9700 (Applied Biosystems, USA) according to manufacturer’s instructions. MiRNAs and mRNA-specific primers were used for PCR using U6 as the housekeeping primer for miRNAs detection and using ACTB for gene transcripts. The primer sequences were designed in the laboratory and synthesised by Generay Biotech (Generay, PRC) based on the miRNA sequences obtained from the miRBase database and mRNA sequences obtained from the NCBI database as follows: hsa-miR-142-3p, GSP: 5’GGGGGTGTAGTGTTTCCTA3’, R: 5’CAGTGCGTGTCGTGGA3’; hsa-miR-136-3p, GSP: 5’GGGGACATCATCGTCTCAAAT3’, R: 5'GTGCGTGTCGTGGAGTCG3’; hsa-miR-146b-5p, GSP: 5’GGGGTGAGAACTGAATTCCA3’, R: 5'GTGCGTGTCGTGGAGTCG3’; hsa-miR-146a-5p, GSP: 5’GGGTGAGAACTGAATTCC3’, R: 5’TGCGTGTCGTGGAGTC3’; hsa-miR-608, GSP: 5’AGGGGTGGTGTTGGGACAG3’, R: 5'GTGCGTGTCGTGGAGTCG3’; U6, F: 5’GCTTCGGCAGCACATATACTAAAAT3’, R: 5’CGCTTCACGAATTTGCGTGTCAT3’; APC, F: 5’GATGAACAAGTTTACCCAGCC3’, R: 5’TCTCTATGCACATCATGTGACC3’; CTNNB1, F: 5’ACAGATCCAAGTCAACGTC 3’, R: 5’AGCTGAACAAGAGTCCCA3’; AXIN2, F: 5’CTTATTGGGCGATCAAGACG 3’, R: 5’TGAATCCATTGCAGGCAAAC3’; ACTB, F: 5’CCATCATGAAGTGTGACG 3’, R: 5’GCCGATCCACACGGAGTA3’. Reactions were carried out in an ABI Prism 7900 HT Sequence Detection System (Applied Biosystems) using the miScript SYBR Green PCR Kit (for real-time polymerase chain reaction [qRT-PCR]; Qiagen) according to manufacturer’s instructions. Each tissue was run in independent experiments in triplicate. After PCR amplification, the relative expression of miRNAs and mRNAs was calculated based on the 2-ΔCt methods.[28] The relative fold-change of miRNAs and mRNAs between SL vs MSL and ML and MML was calculated based on the 2-ΔΔCt methods.[29]
Cell culture, transfection of miRNA mimics, signalling detection, and cell proliferation assay: Ishikawa cells (acquired from Key Laboratory of Birth Defects and Related Diseases of Women and Children, Sichuan university, Chengdu, China) were used instead of primary uterine leiomyoma cells due to growth failure. Ishikawa cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM, Gibco, Carlsbad, CA) mixed with 10% foetal bovine serum (FBS, Gibco) and 1% penicillin and streptomycin (Gibco). All cells were cultured in a 37℃incubator containing 5% CO2. Ishikawa cells were seeded at a density of 1 106/well in a 24-well dish and cultured for 12 h. Following, transfection of miR-142-3p mimics (25 nM and 250 nM) and its negative control (RiboBio, Guangzhou, China) was performed using Lipofectamine 3000 (Invitrogen) according to the manufacturer’s instructions. Cells were treated with 30 M LiCl 12 h after transfection and incubated for another 24 h. Further, the transfection effects of miR-142-3p mimics and CTNNB1, APC, and AXIN-2 gene transcripts were examined by qRT-PCR. The inhibition rate of cell proliferation was measured by CCK8 (Jikai Gene, China) at 12, 24, 36, and 48 h after transfection according to the manufacturer’s instructions. Optical density (OD) was measured by Varioskan Flash (Thermo Scientific) at a wavelength of 450 nm.
Statistical analysis: Quantitative data of each miRNA and mRNA were recorded as mean ± S.E.M. A two-way ANOVA with repeated measures was used for integral data analysis as experimental group was one factor (two groups based on number of leiomyomas) and site was a repeated measure (paired leiomyoma with corresponding myometrium). Two-tailed paired Student’s t-tests were performed for RNA dysregulated level between paired leiomyomas and myometrium. Two-tailed independent Student’s t-tests were performed between SL and ML, MSL and MML. Detailed statistics are shown in Supplementary file 1-2. SPSS 23.0 (SPSS) was used for analyses. GraphPad Prism 6.0 (GraphPad Software, Inc) was used for figure drawing. Statistical significance was defined as P < 0.05.