Cell culture
The human BCa cell lines T24, UM-UC-3, 5637, and 253J and the normal urothelium cell line SV-HUC-1, which is an SV-40 immortalized human uroepithelial cell line, were purchased from the American Type Culture Collection (ATCC, Manassas, VA, USA). The cell lines mentioned above (except for 5637) were maintained in DMEM culture medium, and 5637 cells were cultured in RPMI-1640 medium supplemented with 10% FBS (Gibco, Grand Island, NY, USA) and 1% antibiotic-antimycotic (HyClone Laboratories, Logan, UT) at 37°C aired with 5% CO2 and 95% humidity in a cell incubator. The T24-L subcellular line containing luciferase was generated as described in previous research10 and cultured in DMEM under the same conditions described above. All cell lines used in the research were at early passages.
Chemicals and reagents
MTT purchased from Sigma-Aldrich Co. (St. Louis, MO, USA) was dissolved in 5 mg/ml with PBS (phosphate-buffered normal saline). Transwell chambers with 8 µM pore polycarbonate membrane filters were purchased from Millipore (Darmstadt, Germany). TGF-β (10 ng/ml), EGF (20 ng/ml), and bFGF (10 ng/ml) were purchased from PeproTech (New Jersey, USA). Tumor necrosis factor-alpha (TNF-α, Invitrogen, Carlsbad, CA, USA), as an activator of the NF-ĸB signaling pathway, was obtained from Invitrogen, and the final concentration was 10 ng/ml in culture medium maintained for 24 h in subsequent experiments. 5-Aza-2’-deoxycytidine used to induce demethylation in bladder cancer cells at a concentration of 2.5 µM or 5µM for 72 hours was purchased from TargetMol (Boston, USA).
MTT assay
Bladder cancer cells in the logarithmic growth phase were treated with the indicated treatment, and then the viability of the bladder cancer cells was detected by a 3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium bromide (MTT) (Sigma, St. Louis, MO, USA) assay. The specific procedure was as follows. Bladder cancer cells were suspended at a concentration of 20,000 cells per milliliter and seeded into 96-well plates at 200 µl per well. After incubation in the cell incubator for a specific time, 20 µl MTT was added to 180 µl complete medium per well. Four hours later, the absorbance was measured at 490 nm by an ELISA reader (Bio-Rad, Hercules, CA, USA). The data are the result of three independent experiments.
Bisulfite sequencing PCR (BSP)
CpG islands are closely related to the methylation level of genes. CpG islands in the promoter region of ITPR3 were predicted by MethPrimer (http://www.urogene.org/methprimer/). Genomic DNA (1 µg) from bladder cancer cells and SV-HUC-1 cells was modified and purified with sodium bisulfite using the EpiTect Bisulfite Kit (Qiagen, cat: 59824 Hilden, Germany). Bisulfite genomic sequencing was used to analyze the methylated CpGs in the ITPR3 promoter, and the primers used for bisulfite sequencing PCR were ITPR3 F: 5’-ATTTGTATGTGTGTGGTGGTTT-3’ (sense) and 5’-TAAAACCATTAACRAAACCCTC-3’ (antisense). Amplified bisulfate PCR products were cloned into the pMD18-T simple vector (Takara, Dalian, China). Ten bacterial colonies containing 43 methylation sites were selected for sequencing at Sangon Biotech (Shanghai, China).
Clinical specimens, tissue chip and immunohistochemistry (IHC) assays
All BCa and normal tissues were obtained from the Department of Urology, The First Affiliated Hospital of Xi’an Jiaotong University, Xi’an, China. All clinical samples used in the research were approved by the Ethical Committee of the Hospital, and consent was obtained from all BCa patients. To investigate the expression of ITPR3 in BCa and matched normal tissues, we purchased a BCa tissue chip (Cat No. HBlaU060CS02) from Outdo Biotech Co., Ltd. (Shanghai, China) containing 30 individual BCa patient tissues, with each adjacent noncancerous tissue placed beside its matched cancer tissue. The tissue microarray slide was deparaffinized at 60°C for 4 h, rehydrated in graded solutions of ethanol (100, 95, 80, 70 and 50%) for 3 min, and then subjected to antigen repair at 121°C for 5 min and endogenous enzyme blocking at room temperature for 60 min. After blocking with 5% BSA for 1 hour, the tissue chip was incubated with the primary antibody at 4°C overnight. On the second day, after incubation with Envision-HRP secondary antibody for 30 min at room temperature, the images were detected by an Olympus BX51 microscope (Olympus Corporation, Tokyo, Japan) after staining with a DAB kit according to the manufacturer's protocols. The staining images were assessed according to the staining intensity (0, 1, 2+, 3+) and the percentage of positive cells (0 (0%), 1 (1–25%), 2 (26–50%), 3 (51–75%) and 4 (76–100%)). The degree of protein expression in the image was evaluated by the combination of the staining score and the percentage of positive cells and presented in the way of (0 score), weak (1–4 score), moderate (5–8 score) and strong (9–12 score).
Plasmid transfection and lentiviral infection
The lentiviral vector (Psi-LVRU6GP), which encodes short hairpin RNA (shRNA) targeting ITPR3 and scramble control shRNA, was constructed by GeneCopoeia (Guangzhou, China). The lentiviruses were packaged to improve the transfection efficiency according to the procedure described previously11. Lentivirus-overexpressing CD44 and empty lentivirus vectors were obtained from GeneChem Company (Shanghai, China). The cells were used for subsequent experiments after lentivirus transfection for 48 h with 8 μg/ml polybrene existed.
Wound healing assay
The wound healing assay was executed to assess the migration ability of 5637 and 253J cells under specific conditions. The cells were seeded into 6-well plates with the marker lines across the bottom side and scratched with a 200 μl pipette tip to mark the distance when the cell density reached almost 100%. Serum-free medium was added to the 6-well plates, and images were captured by an inverted microscope (Olympus, Tokyo, Japan) every 24 hours until the scratch was almost closed. This experiment was repeated in triplicate.
Transwell assay
Migration and invasion assays were performed via Boyden chambers with an 8-μm pore size (Millipore, Germany) to evaluate the migration and invasion abilities of bladder cancer cells under given conditions. For the migration assay, chambers plated into 24-well plates were seeded with 4x104 5637 and 2x104 253J cells suspended in 200 μl serum-free culture medium in the upper chamber without Matrigel, and 800 µl medium with 10% FBS was added to the lower chamber for 24 h. For the invasion assay, 8x104 5637 and 4x104 253J suspended in 200 μl serum-free culture medium were added to the upper chamber with 60 µl Matrigel (Sigma, St. Louis, MO, USA) and incubated in a cell incubator at 37°C for 4 h, and 800 µl medium with 10% FBS was added to the lower chamber for 48 h. After washing with PBS three times, fixing with 4% paraformaldehyde for 15 min and staining with 0.1% crystal violet for 5 min, the visible cells were observed and counted under an inverted light microscope (magnification, ×100) in three random fields for each chamber. The experiment was executed in triplicate.
Immunofluorescence assay
Immunofluorescence assays were conducted as previously described12. Briefly, BCa cells were fixed with 4% paraformaldehyde, permeabilized with 0.5% Triton-100 in PBS, blocked with 5% BSA (bovine serum albumin) and incubated with the indicated primary antibodies dissolved in PBS 1:200 at 4°C overnight. After incubation with the fluorescent secondary antibody at room temperature for 1 h, staining with DAPI for 5 min in the dark and sealing with glycerin, the stained images were captured under a positive fluorescence microscope (Olympus, Tokyo, Japan). The experiments were performed at least in triplicate.
Quantitative RT-PCR
The total RNA was isolated from BCa cells with RNAfast 200 reagents (Feijie Biotechnology, Shanghai, China) according to the manufacturer's instructions, quantified by absorbance at 260 nm and reverse-transcribed to complementary DNA using a Prime Script RT-PCR kit (Takara Bio Dalian, China). The cDNA was amplified to detect the expression of specific genes using a CFX96 Real-Time PCR system (Bio-Rad, CA, USA) with SYBR-Green PCR Master Mix (Takara Bio, Dalian, China). Gene-specific primers were as follows: ITPR1, F: GCGGAGGGATCGACAAATGG and R: TGGGACATAGCTTAAAGAGGCA; ITPR2, F: CACCTTGGGGTTAGTGGATGA and R: CTCGGTGTGGTTCCCTTGT; ITPR3, F: CCAAGCAGACTAAGCAGGACA and R: ACACTGCCATACTTCACGACA; and 18S, F: CAGCCACCCGAGATTGAGCA and R: TAGTAGCGACGGGCGGTGTG. Gene mRNA expression levels were assessed by the 2−ΔΔCt method. 18S was used for normalization.
Western blot assay
After treatment with specific experimental conditions, the total proteins were isolated with RIPA lysis buffer (Catalog Number P0013B, Beyotime, China) with a protease inhibitor, phosphatase inhibitor and 0.1 M PMSF (Catalog Number ST506, Beyotime, China). Nuclear and cytoplasmic proteins were extracted using a Nuclear Extraction Kit (Abcam, ab113474, Shanghai, China). The collection of proteins and western blot assays were performed as previously described12. The following antibodies were used in the experiment: ITPR3 (BS72246) used for WB was purchased from Bioworld Technology. Inc., and ITPR3 (ab264282) used for IHC was purchased from Abcam. ITPR1 (19962-1-AP), E2F1 (12171-1-AP), Cyclin D1 (26939-1-AP), Cyclin B1 (55004-1-AP), CDK2 (10122-1-AP), P21 (10355-1-AP), MMP2 (10373-2-AP), MMP9 (10375-2-AP), CD44 (15675-1-AP), P63 (12143-1-AP), OCT4 (11263-1-AP), and KLF4 (11880-1-AP) were purchased from Proteintech Group. SOX2 (A0561) and β-actin (AC026) were purchased from Abclonal. E-cadherin (3195), N-cadherin (13116), vimentin (5741), Snail (3879), and Slug (9585) were purchased from CST (Cell Signaling Technology).
Colony formation assay and tumorsphere formation assay
After treatment with various desired conditions, 5637 and 253J BCa cells were seeded into 6-well plates at 1000 cells per well and incubated in a cell incubator for seven days with the medium replaced every 48 hours. After washing with PBS three times, the cells were fixed with 4% paraformaldehyde for 15 min and stained with 0.1% crystal violet for 5 min to make the cells visible. The clonogenicity was assessed by counting the number of colonies in five random fields at 100X magnification. The experiments were conducted in triplicate. BCa cells were suspended and seeded into 6-well ultralow attachment plates with 3 ml/well cancer stemness medium containing 2xB27, 1xN2 supplement, 20 ng/ml EGF (epidermal growth factor) and 10 ng/ml bFGF (basic fibroblast growth factor). After cultivation for two weeks, tumorsphere formation was counted and analyzed by microscopy in five random fields. The experiment was executed in triplicate.
Cell flow cytometry analysis
Human BCa cell lines 253J and 5637 were maintained in DMEM or RPMI-1640 medium supplemented with 10% FBS in 6 cm dishes. After treatment with the given conditions, the cells were collected and suspended in PBS, fixed with 70% ice-cold ethanol at 4°C overnight and then incubated with 50 μg/ml PI (propidium iodide) and 100 μg/ml RNase A (1:1) in PBS at room temperature in the dark for at least 15 min. Finally, a FACSCalibur™ flow cytometer (BD Biosciences, Franklin Lakes, NJ, USA) was used to assess the staining signals of the BCa cells, and Cell Quest software version 3.3 (BD Biosciences) was used to analyze the percentage of cell cycles distributed according the manufacturer's instructions. The experiment was repeated three times.
EdU assay
The proliferation ability of BCa cells was detected by EdU assay using the EdU Cell Proliferation Kit with Alexa Fluor 594 (Beyotime, China). Cells were washed with PBS three times and incubated with complete medium with 10 µM EdU in a cell incubator for at least 2 hours. Then, the cells were washed with PBS to remove the EdU probe and culture medium, fixed with 4% paraformaldehyde for 10 min at room temperature, and stained with DAPI for 5 min in the dark. The cells were observed under a positive fluorescence microscope (Olympus, Tokyo, Japan) at 100x magnification in five random fields. The staining signals were captured, analyzed, and shown as fold changes compared with the control. The experiment was repeated three times.
Gene Set Enrichment Analysis
The mRNA expression data of 408 BCa patients were downloaded from The Cancer Genome Atlas (TCGA) database (https://www.cancer.gov/tcga). The ITPR3 high-expression group (top 25%, 102 of 408 patients in TCGA FPKM cohort) and ITPR3 low-expression group (top 25%, 102 of 408 patients in TCGA FPKM cohort) were set up. Gene Set Enrichment Analysis (GSEA) 2.0 software was used to analyze the significantly changed pathways and top 100 altered genes of the two groups after the data were submitted to the software and the hallmark gene sets were selected for analysis (http://software.broadinstitute.org/gsea/msigdb/collections.jsp#H)13.
Xenograft tumor model and tail vein cancer metastasis model
All male athymic nude mice used in the study were approved by the Ethical Committee of the First Affiliated Hospital of Medical College, Xi'an Jiaotong University, Xi'an, China. Ten 4-week-old nude mice were randomly separated into two groups and injected subcutaneously in both flanks with 100 µl serum-free culture medium containing 50 µl Matrigel and 5x106 5637 cells (shCon or shITPR3) after 7 days of feeding. Then, the mouse weight and tumor size were recorded and measured every three days until the nude mice with tumors were euthanized to harvest the tumors at day 30. The tumors were weighed, measured, and then stained by immunohistochemistry. The formula for calculating the tumor volume was (length × width 2) × 0.0.5. The total protein of the tumors was extracted with RIPA lysis buffer and detected by a western blot assay. A nude mouse tail vein cancer metastasis model was established as previously described12. Briefly, ten 4-week-old nude mice were randomly divided into two groups, and 2x106 T24-L BCa cells (shCon or shITPR3) labeled with luciferase suspended in 200 µl serum-free culture medium were injected via the tail vein with an insulin needle after 7 days of feeding. Bioluminescence imaging (BLI) was performed to monitor distant metastasis in the lung and other organs at day 30 after injection with 450 mg/kg D-luciferin (Abcam, ab143655, Shanghai, China). Lungs with distant metastatic foci were obtained from nude mice to observe the number of lung surface metastatic foci and then stained by hematoxylin-eosin (HE) and immunohistochemistry after the mice were euthanized.
Bioinformatics and statistical analysis
The GSE3167 dataset used to analyze the expression of ITPR3 between tumor and normal tissues and the GDS183 dataset used to detect the expression in different clinical stages were downloaded from NCBI GEO (Gene Expression Omnibus). The expression level of ITPR3 in bladder cancer and normal tissues and the overall survival and disease-free survival related to ITPR3 mRNA expression level were analyzed with GEPIA (http://gepia.cancer-pku.cn/) and cBioPortal (www.cbioportal.org) for The Cancer Genome Atlas (TCGA). ITPR3 mRNA expression in multiple kinds of cancers, including bladder cancer, was analyzed from the Oncomine database (https://www.oncomine.org/). Briefly, the differences between two groups were analyzed by Student's t-test implemented with GraphPad Prism 7.0 software (GraphPad, CA, USA). The data are presented as the mean ± SD of three independent experiments. P < 0.05 indicated statistical significance.