Mouse model
Female C57BL/6J mice (6–8 weeks) were purchased from JSJ Laboratory (Shanghai, China) and bred under specific pathogen-free conditions at the animal center of Zhongshan Hospital, Fudan University (Shanghai, China). All experimental protocols were approved by the Animal Care and Use Committee of Zhongshan Hospital. Mice were anesthetized with isoflurane and sensitized by intranasal instillation of HDM extract (10 µg; Greer Laboratories, Lenoir, NC, USA) in 40 µL of phosphate-buffered saline (PBS) on days 0, 1, and 2. From day-8 to day-12, mice were challenged daily by intranasal administration of HDM (10 µg in 40 µL of PBS). Control mice were given, via the intranasal route, 40 µL of PBS during sensitization and challenge phases. Two weeks before the first sensitization, mice were administered, via the intratracheal route, adeno-associated virus (AAV) (30 µL; 6.32 × 1012 viral particles/mL; Vigene Biosciences, Shandong, China) containing SERPINB10 short hairpin (sh)RNA or scrambled shRNA. The sequence of SERPINB10 shRNA was GCAGAACCACAATCTGTTAACTTCAAGAGAGTTAACAGATTGTGGTTCTGCTTTTTT. Mice were sacrificed for evaluation on day-14.
RT-qPCR and Western blotting
RT-qPCR and Western blotting were performed as our previous study[11] and the protocol is given in the supplementary Materials and Methods. The primer sequences of all genes for PCR are listed in Supplementary Table S1.
Analyses of bronchoalveolar lavage fluid (BALF)
BALF was collected according to a method described previously[13]. BALF was centrifuged at 500 × g for 8 min at 4℃. The cell-free supernatant was collected for cytokine analyses using ELISA kits. Cell pellets were resuspended in PBS and the total cell number was counted using CellDrop® (DeNovix, Wilmington, DE, USA). Cells were analyzed by flow cytometry using PE-conjugated anti-SiglecF (eBioscience, San Diego, CA, USA), FITC-conjugated anti-CD3 (BD Biosciences, San Jose, CA, USA), APC-conjugated anti-CD11c (Multiscience, Zhejiang, China), FITC-conjugated anti-CD19 (BioLegend, San Diego, CA, USA), Percp-cy5.5-conjugated anti-Ly6G (BioLegend) and PE-cy7-conjugated anti-MHC II (BioLegend).
Flow cytometry of lung tissues
We wished to calculate the number of Th cells in lungs. Lung tissues were immersed in Hank’s medium containing collagenase IV (1 mg/mL) and DNase I (20 µg/mL). Lung tissues were ground using a gentleMACS® Dissociator (Miltenyi Biotec, Bergisch Gladbach, Germany) and then incubated with shaking at 100 rpm for 30 min at 37℃. Digested tissues were filtered through 70-µm nylon mesh, treated with red blood cell lysis buffer, and washed with staining buffer (PBS containing 2% fetal bovine serum). Cells were first incubated with purified anti-mouse CD16/32 (eBioscience) for 10 min (to block Fc receptors) and then stained with a mixture of Percp-cy5.5-conjugated anti-CD3e (BioLegend), BV510-conjugated anti-CD4 (BD Bioscience) and APC-cy7-conjugated anti-CD45 (BioLegend) for 30 min on ice. For intracellular staining, cells were fixed and permeabilized with Transcription Factor Buffer Set (BD Pharmingen, Franklin Lakes, NJ, USA) before addition of AF647-conjugated anti-GATA3 (BioLegend), BV421-conjugated anti- T-bet (BD Pharmingen) and PE-conjugated anti-active caspase-3 (BD Pharmingen). After washing, samples were analyzed by an Arial III flow cytometer (BD Biosciences) and data were analyzed using FlowJo® (Tree Star, Ashland, OR, USA).
Histology
The left lobes of mouse lungs were isolated and fixed in 4% paraformaldehyde. Lung sections were stained with hematoxylin and eosin (H&E) and periodic acid Schiff to assess infiltration of inflammatory cells, goblet-cell metaplasia, and mucus production.
Measurement of levels of HDM-specific IgE and cytokines
Mouse ELISA kits for IL-4, IL-5 and IL-13 in BALF (R&D Systems, Minneapolis, MN, USA) and HDM-specific IgE in serum (JingKang Biotech, Shanghai, China) were used to measure protein expression according to manufacturer instructions. The cytokines in supernatants produced by polarized T cells were stained using the LEGENDplex® panel for human Th cytokines (BioLegend) and measured by flow cytometry.
Clinical samples
Patients with asthma were diagnosed by a physician. Demographic information (Table 1) and blood samples from 16 patients were collected for study. Written informed consent was obtained from all patients. This study was approved by the ethics committee of Zhongshan hospital, Fudan University.
Table 1
| Asthma (n = 16) |
Age, year | 35 (18,66) |
Sex, M:F | 6:10 |
Body mass index | 23.8 ± 3.6 |
FEV1, % predict | 90.6 ± 13.6 |
FENO, ppb | 51.9 ± 45.8 |
Total IgE, IU/ml | 223.0 ± 225.8 |
Values were presented as mean (range) or mean ± SD. FEV1, forced expiratory volume in the first second; FENO, fraction of exhaled nitric oxide. |
Polarization of Th1 and Th2 cells in vitro
Heparinized venous blood was collected from patients with asthma. Then, it was diluted (1:1) with PBS and layered on Lymphoprep® (StemCell Technologies, Vancouver, Canada) density-gradient medium and centrifuged for 20 min at 800 × g at room temperature. The layer of peripheral-blood mononuclear cells was collected, washed and resuspended in RoboSep® Buffer (StemCell Technologies). Naïve CD4+CD45RA+CD45RO− T cells were negatively selected and enriched using EasySep® Human Naïve CD4 + T Cell Isolation Kit II (StemCell Technologies) according to manufacturer instructions. The purity of the final isolated fraction (as determined by flow cytometry using FITC-conjugated anti-CD4, PE conjugated anti-CD45RA and APC-conjugated anti-CD45RO (BioLegend)) was 97%. Purified naïve CD4+ T cells were cultured in ImmunoCult®-XF Cell Expansion Medium (StemCell Technologies) and stimulated with plate-bound anti-CD3 (2 µg/mL) and anti-CD28 (4 µg/mL; Peprotech-BioGems, Westlake Village, CA, USA). ImmunoCult Human Th1 Differentiation Supplement (StemCell Technologies) and ImmunoCult Human Th2 Differentiation Supplement (StemCell Technologies) were added to direct the differentiation of Th1 and Th2 cells, respectively. After 3–4 days, cells were expanded under identical conditions in the absence of anti-CD3 and anti-CD28. Then, cells were re-stimulated every 7 days. If required, cells were activated with Leukocyte Activation Cocktail (BD Pharmingen) for 6 h.
Knockdown of SERPINB10 expression in T cells
Lentivirus containing SERPINB10 shRNA or scrambled shRNA were used to transduce CD4+ T cells. The sequence of SERPINB10 shRNA was GCCTGTTAACTTTGTGGAA. Naïve CD4+CD45RA+CD45RO− T cells were stimulated with plate-bound anti-CD3 and anti-CD28. After 48 h, they were transduced with lentivirus (multiplicity of infection = 100) by centrifugation at 500 × g for 90 min at room temperature in polybrene (6 µg/mL) and then cultured at 37℃ in a chamber containing 5% CO2. After 3 days, cells were analyzed by flow cytometry for expression of CD4 and green fluorescent protein (GFP). If required, GFP+ cells were sorted by flow cytometry and cultured under polarization conditions.
Statistical analyses
Data are the mean ± SEM and were analyzed using Prism 8 (Graph Pad, San Diego, CA, USA). Differences were assessed using the unpaired Student’s t-test between two groups, and one-way analysis of variance with Tukey’s multiple comparison test among three groups. P < 0.05 was considered significant.