Cell culture and treatments
Hepatocyte cells (LO2) and HCC cell lines (Hep3B, Huh7, HCCLM3 and MHCC-97H), were cultured in DMEM medium (Gibco) containing 10% FBS (Gibco) with 5% CO2 at 37°C. For gene knockdown or over expression, Huh7 and HCCLM3 cells were grown to confluence and transfected with shRNA (sh-CD36, TTGTACCTATACTGTGGCTAAATGAGAC) or shcontrol using lipo3000 (Life Technologies) for 48 h, then the protein and mRNA were extracted for protein and RNA expression analysis. For induced steatosis, Huh7 cells were cultured in six-well plates at 5×105 cells/well. The cells were treated with 0.4 mM palmitic acid (PA) or 1% bovine serum albumin (BSA)solution for 24 h and used for laboratory analyses.
Clinical samples
To verify the expression of CD36 in HCC, tumor and adjacent normal tissue samples were obtained from 48 HCC patients at the Affiliated Hospital of Yangzhou University. All patients underwent surgical resection and were followed up until December 2020. The median follow-up time was 25.5 months (range, 15–70). All the enrolled patients provided written informed consent. Each tissue sample was diagnosed as HCC by two different professional pathologists.
qRT-PCR analysis
As described above, RNA was isolated and cDNA was obtained using primescrip RT Master Mix (Takara, Tokyo, Japan). Gene expression of CD36 and AKR1C2 was quantified by the StepOnePlus Real-Time PCR System (Life) and ChamQ SYBR Color qPCR Master Mix (Vazyme Biotech, Nanjing, China). Primer pair sequences were as follows: CD36 forward: 5′-GAACCACTGCTTTCAAAAACTGG-3′ and reverse: 5′-GTCCTGAGTTATATTTTC CTTGG-3′; AKR1C2 forward: 5′-CTGTGAGGGAGGAAGAAACATTTGCTAA-3′ and reverse: 5′-GGCTTCTATTGCCAATTTGACGGC-3′; β-actin, forward: 5'-GG GAAATCGTGCGTGACAT-3' and reverse: 5'-CTGGAAGG TGGACAGCGAG-3'.
Western blot
Total proteins were extracted from cells and liver tissues with lysis buffer, then quantified by BCA (Pierce, Rockford, IL, USA). Separating proteins via SDS-PAGE and then transferring onto PVDF membranes (Invitrogen, USA) by electroblotting. Subsequently the membranes were blocked and followed by incubation with primary antibodies. Primary antibodies: CD36 (1:5000, Abcam, ab133625), AKR1C2 (1:5000, Abcam, ab179448), FASN (1:10000, Abcam, ab128870), ACC1 (1:5000, Abcam, ab109368), FABP5 (1:1000, Abcam, ab255276) β-actin (1:5000, Abcam, ab8226) and secondary antibody IgG (1:10000, Abcam, ab205718). Protein bands were observed using an enhanced chemiluminescence kit (Pierce, Rockford, USA).
Animal experiment
5–6-week-old nude BALB/c mice (Model Animal Research Center of Nanjing University, Nanjing, China) were raised to study the effect of CD36 on HCC development in vivo. The mice were divided into 3 groups with 8 mice in each group by random numbers. Huh7 cells (2 × 106)were stably transfected with sh-CD36 and sh-control group, then the cells were subcutaneous injected to establish the transplanted tumor model in nude mice. One week after vaccination, the tumor growth was recorded via measuring the tumor volume every week. 5 weeks after inoculation, tumor samples were collected and weighted.
Hematoxylin and eosin (H&E) staining staining
The liver tissue was fixed at 4°C in 4% paraformaldehyde for 24 h, then dehydrated, embedded in paraffin and sectioned into 4 µm sections subsequently for H&E staining. The results of stained tissue sections were evaluated by a committee certified pathologist.
Immunohistochemistry (IHC)
HCC tissues were consecutively cut into 4-µm slices and then mounted on slides. The sections were dewaxed and then washed with Tris-buffered saline (TBS). Antigen retrieval was performed using EDTA antigen repair solution.After soaking and blocking, the sections were incubated with a primary antibody against AKR1C2 (1:500, Abcam, ab96087) overnight at 4°C. The following day, the sections were soaked in TBST, then incubated with an anti-rabbit secondary antibody for 45 min at 37°C, washed, stained with hematoxylin, and sealed with a sealing agent. After drying, the sections were examined and photographed under an microscope (Olympus, BX63).
Quantifcation of phospholipids and triglycerides
According to the procedure provided in the kit, we measured the contents of intracellular phospholipids and triglycerides content were assayed by EnzyChrom™ phospholipids assay kit and EnzyChrom™ triglycerides assay kit from Hayward (BioAssay Systems, CA, USA) respectively.
Quantifcation of neutral lipid
The lipophilic fluorescence dye BODIPY 493/503 (Invitrogen) was employed for monitoring the neutral lipid accumulation in A549 cells according to the manufacturer’s instructions. Briefly, cells were washed in Phosphate Buffered Saline (PBS), fixed with 4% paraformaldehyde and stained with BODIPY 493/503 (1 µg/mL) for 45 min at room temperature, and then nuclei were counterstained with Hoechst for 15 min. The results of immune staining were detected using a fluorescence microscope (Olympus, Tokyo, Japan).
CCK-8 assay
Cells were cultured in 96 well plates, CCK-8 analysis was used to evaluate cell viability of Hun7 cells and HCCLM3 cells. We added Cell counting kit-8 (CCK-8) solution (10 µL of CCK-8, Dojindo, Japan) to each well, and then cultured for 1–3 h at 37°C. The absorbance at 450 nm was measured by a microplate reader (Thermo,USA), the obtained data were sorted and analyzed.
Clone formation assay
Hun7 cells and HCCLM3 cells were seeded in 6-well plates and further transfection or treatment was carried out as required by the experiments (800 cells/well). After cultured for about 10 days, Hun7 cells and HCCLM3 cells were fixed with 4% paraformaldehyde. Further, the plates were washed and dried. Finally, the number of clones were counted (> 50 cells/clone).
Wound healing assay
Post 48 h transfection, Hun7 cells and HCCLM3 cells were reseeded in 6-well plates. Subsequently, a straight scratch wound was created in the center of each well with a micropipette tip. Scratch width was monitored to the length at 0 h or after 48 h with inverted microscope (Olympus, Japan). The migration of the cells was assessed by measuring and comparing the gap area caused by the scratch in the well.
Cell invasion assay
For the cell invasion assay, matrigel (BD Biosciences, 354480, USA) was used to precoat the chamber (Corning, 3422, USA) and incubated for 1 h. Then Hun7 cells and HCCLM3 cells (5 × 105 cells) were seeded on the upper chamber, and DMEM medium containing 20% FBS was added to the lower chamber. After 12 h incubation, all cells were fixed and stained, then staining the invaded cells with Calcein-AM and counting under a microscope (200 × magnification) in at least five random fields.
Transcriptome sequencing
For whole transcriptome sequencing, RNA from 1x107 Huh7 cells of different transfection groups was extracted using the Trizol reagent kit (Invitrogen, Waltham, MA, USA) and then quantified using NanoDrop 2000 (Thermo Fisher Scientific, Waltham, MA, USA). The whole transcriptome RNA-seq was performed using the Ion Total RNA-Seq kit, the Ion PI™ Chip kit, the Ion PI™ Template OT2 200 kit, and the Ion PI™ Sequencing 200 kit based on the protocols of Life Technologies Corp (Waltham, MA, USA). In brief, 100 µg of total RNAs for each sample was purified using oligo-dT beads and then fragmented. Reverse-transcribing the cleaved RNA fragments into first-strand cDNA, followed by second-strand cDNA synthesis. After that, a single ‘A’ base was added to the cDNA fragments at the 3' end. PCR amplification was used to generate the final cDNA library.Finally, RNA-seq was performed on the sequencing template according to the standard protocol with the ion proton system (Life Technologies).
Statistical analysis
All graphs were statistically analyzed using Graphpad Prism 8.0 (GraphPad Software, La Jolla, USA), and the results of three experiments were used for SEM detection. The differences between two groups were compared with Student’s t-test. Data of this study were shown as mean ± SD. P < 0.05 was considered statistically significant.