Animals
Seventy 4-week-old male C57 mice and twenty male Wistar rats weighting 200-300 g were purchased from Shanghai SLAC Laboratory Animal Co., Ltd. (production licence No. SCXK, Shanghai 2017-0011). The animals were kept in the SPF environment of the Animal Center of Shanghai University of Traditional Chinese Medicine. An appropriate ambient temperature (20-23°C), humidity (50%-60%) and circadian rhythm (12/12-h light/dark cycle) and free access to drinking water and activities were provided. All experimental procedures were conducted according to the guidelines of the Animal Care and Ethics Committee of the Shanghai Traditional Chinese Medicine University (China). The C57 mice and Wistar rats were subjected to animal experiments and administered serum containing JPQHF.Deep anesthesia was implemented by intraperitoneal injection of 1% pentobarbital sodium at a dose of 50mg/kg body weigh, confirmed by stable breathing and no reaction to pinching tail.After collecting blood from the ventriculus dexter (mice)and abdominal aorta(rats),mice or rats were executed by cervical dislocation under deep anesthesia.
Dosing
The C57 mice were adaptively fed for 1 week. Ten mice were randomly selected as the control group and fed a normal diet after being weighed. The other sixty mice were in the high-fat diet group (HD group) and treated with a diet containing 60% fat (Research Diet, 12492). The mice were fed a high-fat diet for 8 weeks and weighed once a week. After 8 weeks, the forty-five heaviest mice were chosen from the sixty mice in the HD group. A random number table was used to randomly select ten mice from these forty-five mice. An IPGTT was conducted with the selected 10 mice and 10 mice in the control group. The modelling criteria were as follows: (1) the body weight significantly differed between the HD group and control group and (2) the glucose tolerance of mice in the HD group was obviously impaired compared with that in the control group. After confirmation of successful modelling, 45 mice were randomly divided via SPSS26.0 into 3 groups of 15 mice each: the model group (fed a diet containing 60% fat and normal saline), JPQHF group (fed a diet containing 60% fat and JPQHF) and PIO group (fed a diet containing 60% fat and PIO). There was no significant difference in body weight among the 3 groups. Interventions were maintained for 4 weeks.
The JPQHF, composed of 15 g of Dangshen, 15 g of Huangqi, 15 g of Shanyao, 15 g of Huangjing, 3 g of Huanglian, 9 g of Huangqin, 15 g of Gegen and 15 g of Guijianyu, was purchased from Shanghai Kangqiao Traditional Chinese Medicine Decoction Co., Ltd., and had passed quality inspection. A decoction was prepared according to standard procedure[11] and kept at -20°C. The intragastric dose of the decoction administered to the mice was 0.1 ml/10 g. Based on the drug dosing coefficient between mice and humans, the concentration of the decoction was 2.0961 g of crude drug /ml. PIO was dissolved in pure water to 0.6165 mg/ml to generate an effective concentration for dosing. The suspension was shaken well before each intragastric administration.
Preparation of serum containing JPQHF
Thirty Wistar rats were randomly divided into two groups (15/15): the JPQHF group, the rats in which were administered JPQHF decoction at the following dose, and the blank serum group, the rats in which were without intervention. JPQHF was prepared as described above. The final concentration of the decoction was 2.35 g crude drug/ml. The gavage dose was 1 ml/100 g body weight. The rats were intragastrically administered the decoction twice daily at 9 am and 5 pm. Blood was collected from the abdominal aorta on the 5th day at 1 hour after administration. The blood was centrifuged (2500 rpm, 5 min) after incubation at room temperature for 2 hours. Then, the serum was heated in a 56°C water bath for 30 min, stored at -80°C and filtered before each use.
Cell culture and treatment
C2C12 cells were obtained from American Type Culture Collection (ATCC, Manassas, VA, USA) and always cultured at 37°C in a humid 5% CO2 incubator. The cells were cultured in 10% FCS-containing DMEM (4.5 g/L glucose) until reaching 80% confluence in a 25T culture flask for approximately 3 days. Then, the medium was changed to 2% horse serum-containing DMEM (4.5 g/L glucose), and the cells were incubated for an additional 2 days, with the medium changed to fresh medium every day.
The C2C12 cells were cultured in the above medium for 24 hours. The concentrations of BSA, a penicillin-streptomycin solution (100×), blank serum, JPQHF decoction, palmitic acid culture medium and rapamycin were 1%, 1%, 8%, 8%, 0.5 mmol/L and 100 nmol/L, respectively.
The intervention conditions for each group were as follows:
control (Con): BSA culture medium;
palmitic acid (PA): palmitic acid culture medium;
control+blank serum (con+BS): BSA cell culture medium+ blank serum;
palmitic acid+blank serum (PA+BS): palmitic acid culture medium+ blank serum;
palmitic acid+JPQHF serum (PA+JS): palmitic acid culture medium+JPQHF serum; palmitic acid+rapamycin+blank serum (PA+RA+BS): palmitic acid culture medium+rapamycin+blank serum;
control+rapamycin+blank serum (con+RA+BS): BSA culture medium+rapamycin+blank serum.
A penicillin-streptomycin solution (100×) was added to each group. C2C12 cells were cultured in the above media for 24 hours. The concentration of insulin was 100 nm/L, and insulin treatment was carried out for 20 min.
Oil red O staining of the mouse gastrocnemius muscle and C2C12 cells
The tissue samples were taken from the -80°C freezer and placed in a cooling rack. The tissue was quickly transferred to a pre-cooled frozen slicer and sliced to a thickness of 8 μm. After fixation in cold 10% formaldehyde for 10 min, the slices were rinsed with distilled water 3 times and dried it at room temperature for 5 min. The slices were then incubated in propylene glycol for 5 min and immersed in an oil red O solution preheated in an oven at 60°C for 8-10 min. Then, the sliced were differentiated in a 85% propylene glycol solution (100% pure propylene glycol diluted with distilled water) for 10 min and washed 2 times with distilled water. The slices were then dyed for 30 sec in Mayer’s haematoxylin and washed thoroughly with running water for 3 min. The slices were immersed in distilled water, observed under a microscope and photographed.
After different treatment interventions (including palmitic acid, rapamycin and serum containing JPQHF, but not insulin), C2C12 cells were stained with oil red O according to the instructions of a Solarbio Cell Oil Red O staining kit (#G1262).
GPO-PAP assay
Triglyceride levels in the skeletal muscle were measured using the GPO-PAP method performed according to the instructions of a kit (Nanjing Jiancheng Bioengineering Institute, A110-2-1).
PCR
Total RNA was extracted from mouse skeletal muscle with TRIzol (Biomaga, 7311). A two-step method was used to identify the relative expression of RNA in each group according to the instructions of the Takara Reverse Transcription Kit (RR036A) and DNA Amplification Kit (RR820A). The primers were synthesized by Sangon Biotech (Shanghai).Primer sequences were as follows: β-actin: forward (5’-3’) TTACTGCCCTGGCTCCTA, reverse (5’-3’) ACTCATCGTACTCCTGCTTG; Srebp-1c: forward (5’-3’) TGTCTGGGAAGGGAGCATAA, reverse (5’-3’) GCTGTTCTGTGGTTTGTTTACCT; PPAR-γ: forward (5’-3’) ATCGAGGACATCCAAGAC, reverse (5’-3’) CAATCTGCCTGAGGTCTG; Myod: forward (5’-3’) CGCGCTCCAACTGCTCTGAT, reverse (5’-3’) CAGCCGCACTCTTCCCT; and myogenin: forward (5’-3’) GCACTGGAGTTCGGTCCCAA, reverse (5’-3’) ATCCTCCACCGTGATGCTG.
Western blotting (WB)
Total protein was extracted from mouse skeletal muscle and cells by conventional methods. Proteins were quantified by the BCA method (Thermo, RH237552) and separated by SDS-PAGE. The concentration of the stacking gel was 4%, and the concentration of the separating gel was 10% except when the target proteins were mTOR and pmTOR, for which 8% gels were used. Then, the electrophoresed proteins were transferred to PVDF membranes, which were incubated overnight with primary antibody at 4°C. The following primary antibodies were used in this experiment: anti-PI3K (CST, #4249, 1:1000 dilution rate), anti-AKT (CST, #3063, 1:1000 dilution rate), anti-pAKT (CST, #4060, 1:1000 dilution rate), anti-mTOR (CST, #2983, 1:1000 dilution rate), anti-pmTOR (CST, #5536, 1:1000 dilution rate), anti-PPARγ (CST, #2435, 1:1000 dilution rate), anti-myogenin (Absin, #abs101516, 1:1000 dilution rate), and anti-GAPDH (CST, #2118, 1:2000 dilution rate). The next day, the membrane was washed 3 times in TBST (1×). The membranes were then incubated with secondary antibody (BOSTER, BA1050, 1:5000) for 1 hour and washed 3 times in TBST (1×). Then, the blots were photographed and assessed by electrochemiluminescence (ECL).
Statistical analyses
Measured data were analysed with SPSS 26.0. Data with a normal distribution are expressed as the mean ± SD. Differences for which *P-value < 0.05 or **P < 0.01 were considered statistically significant.