Database selection and analysis
We used the databases: Gene Expression Profiling Interactive Analysis (GEPIA: http://gepia.cancer-pku.cn) to perform validation of cancer specific expression and prognosis of the IRF6 genes and KIF20A genes ( 28407145 ) .
In addition, in the light of the expression of Hub genes and its relationship with pathological stage of tumor in GEPIA, one-way ANOVA statistical analysis was used. The overall survival (OS) and disease free survival analyses of the hub genes were performed using the Mantel-Cox test survival method in GEPIA.
We used the databases: The Human Protein Atlas (HPA: http://www.proteinatlas.org/) to perform the expression of IRF6 and KIF20A in renal carcinoma tissues.
We used the JASPAR database (http://www.jaspar.genereg.net)) to predict the possible binding sites of the IRF6 and KIF20A promoters.
Animals
6 healthy female BALB/C nude mice aged 6-8 weeks were selected from Animal Experimental Center. All animal experiments in the present study were approved by the Ethics Committee of The second affiliated hospital of soochow university. All methods were performed in accordance with the United States Public Health Services Guide for the Care and Use of Laboratory Animals, and all efforts were made to minimize the suffering and number of animals used in the present study. The nude mice were raised in SPF conditions. 786-O cells at logarithmic growth stage were inoculated subcutaneously at the right back near the upper limb of nude mice by 6 × 107 unit/ml. Mice were treated for 4 weeks for modeling.
Cell culture
Renal tubular epithelial cell HK2 cell and renal clear cell carcinoma cell line OS-RC-2, 769-P, CaKi-1, UM-RC-2 and 786-O were purchased from the Cell Resource Center of Shanghai Institutes for Biological Sciences (Chinese Academy of Sciences, Shanghai, China). Cells were cultured in RPMI1640 medium containing 10% fetal bovine serum (FBS), and 100μg/ml streptomycin at 37°C with 5% CO2 in a humid incubator.
RT-qPCR
Total RNA was extracted from the cells using TRIzol reagent (Invitrogen, Waltham, Massachusetts). The PrimerScript Real-time reagent kit (TaKaRa, Kusatsu, Shiga, Japan) was performed for total RNA reverse transcription, and then SYBR Premix Ex TaqTM II (TaKaRa, Japan) was used for the quantitation analysis of the expression of IRF6 and KIF20A. We designed the stem-loop with IRF6 and KIF20A sequence (which was used to the primer of reverse transcription) and used stem-loop to complete reverse transcription. The primer sequences for primer source were performed as follows: IRF6: Forward: 5’ CAAAACTGAACCCCTGGAGATGGA 3’ Reverse: 5’- CCACGGTACTGAAAC TTGATGTCC-3’; KIF20A: Forward: 5′-TGCTGTCCGATGACGATGTC-3′ Reverse: 5′-AGGTTCTTGCGTACCACAGAC-3′; GAPDH: Forward: 5′-AGGTTCTTGCGTACCACAGAC-3′ Reverse: 5′-GCCATCACGCCACAGTTTC-3′.
Western blot
Lysis buffer (Sigma, USA) was added to the cells to isolate total protein. The concentration of protein was determined using a bicinchoninic acid assay protein assay kit. Proteins (25 μg/lane) were separated by SDS-10% polyacrylamide gel (Bio-Rad, Hercules, CA) and transferred to membrane of polyvinylidene fluoride (Thermo Fisher Scientific, Waltham, MA). Membranes were then blocked with 5% milk in Tris-buffered saline/Tween-20 for 1 h at room temperature, and then probed overnight at 4°C with the following primary antibodies: anti-IRF6 (1:1000; ab123880; Abcam, Cambridge, MA), anti- KIF20A (1:1000; ab7091; Abcam, Cambridge, MA) (Santa Cruz Biotechnology, Santa Cruz, CA), and anti-GAPDH (ab75478; Abcam, Cambridge, MA). After washing, blots were incubated with the appropriate HRP-conjugated secondary antibody for 2 h at room temperature. Proteins were detected with the enhanced chemiluminescence detection system (Thermo Fisher Scientific, Waltham, MA). The protein bands were visualized using the ChemiDoc XRS System (Bio-Rad), and Image J software were used to detect the blots.
Cell transfection
Overexpression (Oe)-IRF6, Oe-KIF20A, shRNA-IRF6, shRNA-KIF20A and the negative control (NC) were synthesized by GenePharma Co. (Shanghai, China). . All cell transfections were conducted by using Lipofectamine 3000 reagent (Invitrogen, Carlsbad, CA, USA) following the manufacturer’s protocol.
CCK-8
786-O cells (1×105) were inoculated into 96-well plates. The cells were treated accordingly and at 24, 48 and 72 h time intervals post-transfection, 10 µl CCK-8 solution (Beyotime Institute of Biotechnology) was added to each well, and the plates were then incubated for 48 h at 37°C. Optical density (OD) values at 450 nm were determined using an ELx808 absorbance microplate reader (BioTek Instruments, Inc., Winooski, VT, USA).
Colony formation assays
786-O cells (1×106) were inoculated into 6-well plates and transfected for 48 h. Then, the cells were cultured for 14 d at 37°C. After this, cells were stained with 10% Giemsa (Merck, Germany) for 30 min. Colonies containing ≥50 cells were counted under a microscope (Olympus, Japan). Each experiment was repeated three times.
TUNEL Staining
For TUNEL staining, 786-O cells (1×106) were inoculated into 6-well plates and transfected for 48 h. Cells were fixed in freshly prepared 4 % methanol-free formaldehyde solution in PBS for 20 min at room temperature and permeabilized with 0.2 % Triton X-100 for 5 min. 786-O cells were labeled with fluorescein TUNEL reagent mixture for 60 min at 37 °C according to the manufacturer’s suggested protocol. After that, slides were examined by fluorescence microscopy and the number of TUNEL-positive (apoptotic) cells was counted. DAPI was used to stain nucleus.
Wound healing
786-O cells (1×106) were inoculated into 6-well plates and transfected for 48 h. A wound was created by using a 100 µL pipette tip on the cell monolayer and images were taken at 0 h and 24 h to calculate the % of wound healing.
Transwell
The treated cells were inoculated into the upper chamber of 24-well Transwell chamber at the density of 2*105 cell/well. Matrigel glue was laid on the upper chamber and the culture medium with a volume of 600μL containing 10% FBS was added to the lower chamber. After 24 hours of incubation, carefully remove the Transwell chamber and fix it for 20 minutes with 4% polyformaldehyde solution. Then wash it with PBS solution, and wipe out the cells on the surface of the chamber with cotton swabs to crystallize. After purple staining, microscopic observation was carried out. Select six visual fields of each group to photograph and count, and calculate an average. The experiment was repeated independently for three times.
Luciferase assay
The luciferase activity was measured using a plate reader (BD bioscience), and normalized to the transfection efficiency by using a Renilla luciferase activity kit (pRL-TK). All procedures followed the manufacturers’ instructions. All plasmids were constructed by Life Technologies Corporation (Carlsbad, CA).
Chromatin immunoprecipitation assay (ChIP)
Chromatin immunoprecipitation (ChIP) was carried out with a Magna Chromatin Immunoprecipitation kit (Millipore, Darmstadt, Germany). Immunoprecipitation was performed with anti-IRF6 antibody. The final purified DNA fragment was subjected to PCR analysis using Hot-Start Taq DNA polymerase (TaKaRa, Dalian, China; 32 cycles). PCR products were analyzed using gel electrophoresis. ChIP data were shown as the percentage of the input normalized to control purifications.
Immunohistochemical (IHC)
Xenograft tumors were collected and performed on paraffin-embedded sections. 4 μm-thick sections were deparaffinized, rehydrated and then immersed with 3% hydrogen peroxide for 10 min to quench endogenous peroxidase and labeled with antibodies at 4 °C overnight. The slides were stained with the secondary streptavidin-horseradish peroxidase-conjugated antibody (Santa Cruz Biotech, Santa Cruz, CA) for 1 h. The slides were then counterstained with hematoxylin for 30s and cover slipped.
Statistical analysis
Statistical calculations were performed using SPSS 13.0 software (SPSS, Inc., Chicago, IL, USA). The data are presented as the mean ± standard deviation from at least three independent experiments. Statistical analysis was performed by one-way ANOVA. P<0.05 was considered to indicate a statistically significant difference.