Ligands
Mibolerone was purchased from Perkin Elmer (Waltham, MA, USA) and dissolved in ethanol. Dihydrotestosterone (DHT)/ 5alpha-Androstan-17beta-ol-3-one was purchased from Sigma Aldrich (A8380) and dissolved in ethanol. Enzalutamide was from Sigma Aldrich (St. Louis, MO, USA) and was dissolved in DMSO.
Cell Culture
A549, GMK (Vero E6), 293T, LNCaP, H1944 and BEAS-2B were purchased from the ATCC (Manassas, VA, USA). A549 and 293T cells were cultured in Dulbecco's Modified Eagle's Medium (DMEM, Sigma Aldrich), LNCaP and H1944 in Roswell Park Memorial Institute (RPMI, Sigma Aldrich) medium 1640 supplemented with 10% FCS and 2 mM L-glutamine, 100 U/ml penicillin, 100 mg/ml streptomycin (PSG) as previously described60. BEAS-2B were grown in Bronchial Epithelial Cell Growth Medium (BEGM, Lonza, Basel, Switzerland). GMK were grown in DMEM supplemented with 10 % FCS, 1 % non-essential amino acids (NEAA) and PS.
For experiments involving hormone manipulation, cells were incubated in phenol red free DMEM or RPMI (Invitrogen, Carlsbad, CA, USA), supplemented with double charcoal stripped FCS and PSG (First Link UK Ltd., Wolverhampton, UK).
Immunoblotting
Cells were lysed in RIPA buffer (150 mM NaCl, 1 % IGEPAL CA-630, 0.5 % sodium deoxycholate, 0.1 % SDS, 25 mM Tris pH 7.4) containing freshly added protease inhibitors (Halt Protease Cocktail, Thermo Fisher, Waltham, MA, USA). Samples were incubated on ice for 10 min, sonicated 4 cycles of 30 sec on/off (Biorupter, Diagenode, Denville, NJ, USA) and centrifuged (13,000 rpm, 10 min, 4 °C). The DC protein assay (BioRad, Hercules, CA, USA) was used to quantify protein concentrations. 30 mg of protein was separated using SDS-PAGE and immunoblotting performed, as previously described61. Primary antibodies used were rabbit anti-TMPRSS2 (ab92323, Abcam, Cambridge, UK), mouse anti b-actin (ab8226, Abcam), rabbit anti-AR (ab74272, Abcam) and mouse a-tubulin (B-5-1-2, Sigma Aldrich). Secondary HRP-conjugated antibodies (Sigma Aldrich) were used at 1:2000. Proteins were visualised using Immobilon Forte HRP substrate (Merck Millipore, MA, USA) and a Fusion FX Chemi Imager (Vilber Lourmat, Collégien, France).
Quantitative PCR analysis of gene expression in cell lines
Cells were seeded in 12 well plates and incubated + 10 nM dihydrotestosterone ± 10 mM bicalutamide or enzalutamide for 48 or 72 h. RNA was extracted using Trizol (Thermo Fisher), following the manufacturer’s instructions. 250 ng of RNA was reverse transcribed using a LunaScript RT SuperMix Kit (NEB, Ipswich, MA, USA). Alterations in gene expression were quantified using the Luna Universal qPCR Master Mix (NEB) and a Roche 96 qPCR machine (Basel, Switzerland). TMPRSS2 data were normalised to L19 data and the 2(–delta delta CT) method was used to calculate gene expression changes. Human qPCR primers: (5’-3’) TMPRSS2 forward – CCTGTGTGCCAAGACGACTG, TMPRSS2 reverse – TTATAGCCCATGTCCCTGCAG; FKBP5 forward – ATTATCCGGAGAACCAAACG, FKBP5 reverse – CAAACATCCTTCCACCACAG; L19 forward – GCGGAAGGGTACAGCCAAT, L19 reverse GCAGCCGGCGCAAA, GAPDH forward – ATGGGGAAGGTGAAGGTCG, GAPDH reverse – GGGGTCATTGATGGCAACAATA.
Mouse studies
Ptenloxp/loxp;Pb-Cre4 mice (The Jackson Laboratory, Bar Harbour, ME, USA), which have prostate-specific PTEN deletion62, were treated with 50 mg/kg Enzalutamide (in 5% DMSO +1% CMC +0.1% P80 oral gavage) or vehicle control every day for three days. All work was carried out in accordance with the provisions of the Animals (Scientific Procedures) Act 1986 of the United Kingdom. The work was approved by Imperial College Animal Welfare and Ethical Review Body (AWERB) and performed under an appropriate Home Office license (PPL70_8705). Organs were snap frozen until RNA was extracted using a Monarch RNA extraction kit (NEB) following disruption of frozen tissue utilizing mechanical disruption and enzymatic digestion with Proteinase K. 2 mg of RNA was reverse transcribed using Precision Nanoscript2 RT Kit (Primer Design, Southampton, UK). Changes in gene expression were measured using SYBR Green Fast Master Mix (Life Technologies, Carlsbad, CA, USA) and QuantStudio 7 Flex Real-Time PCR System (Applied Biosystems, Foster City, CA, USA). Gene expression data were normalised to L19, Gapdh, and Actb data and the 2(–delta delta CT) method used to calculate changes in expression. Mouse qPCR primers (5’-3’): Tmprss2 forward – GAGAACCGTTGTGTTCGTCTC, Tmprss2 reverse – GCTCTGGTCTGGTATCCCTTG; Ace2 forward – TGATGAATCAGGGCTGGGATG, Ace2 reverse – ATTCTGAAGTCTCCGTGTCCC, Ar forward – TGGGACCTTGGATGGAGAAC, Ar reverse – CTCCGTAGTGACAGCCAGAAL19, Gapdh forward –GCAAAGTGGAGATTGTTGCCAT, Gapdh forward – CCTTGACTGTGCCGTTGAATTT, L19 forward – GAAATCGCCAATGCCAAC, L19 reverse – TCTTAGACCTGCGAGCCTCA, b-actin forward – CCTCTATGCCAACACAGTGC, b -actin reverse – CCTGCTTGCTGATCCACATC.
Analysis of TMPRSS2 expression in tissue and cell line datasets
RNA-sequencing dataset v8 was downloaded from the Genotype-Tissue Expression (GTEx) Project Online Portal63. Gene expression was normalised (inverse normal transformation) across samples, and medians for AR and TMPRSS2 expression across each tissue was calculated. Data from RNA sequencing of isolated single nuclei, performed on surgical specimens of healthy, non-affected lung tissue from twelve lung adenocarcinoma (LADC) patients, was analysed for AR, TMPRSS2, and ACE2 expression using Eils Lab UCSC Cell browser (https://eils-lung.cells.ucsc.edu)42. Sequencing data from T47D cells treated with 10 nM DHT (GSE62243)39, and data from lungs of castrated or intact mice (GSE31341)49 were log2 transformed. Significance was determined by ANOVA. Two single cell seq data sets were investigated. The first dataset of lungs from 9 patients (GSE12296041) was analysed using http://altanalyze.org/, and the second dataset of lungs from 12 donors42 analysed using https://eils-lung.cells.ucsc.edu.
Identification of potential AREs
The AR binding motif, MA0007.2 was obtained from the JASPAR online curated motif database53. Segments of DNA around the TMPRSS2 gene were scanned for potential matches for presence of the MA0007.2 AR motif using FIMO64. Of the 40 possible MA0007.2 matches in regulatory region 1 (P<0.0001) and 34 possible matches in regulatory region 2 (P<0.0001), only response elements that correlated with binding peaks were selected.
Analysis of ChIP-sequencing data
ChIP sequencing data (receptors in the presence of their cognate ligands) were analysed using Cistrome Analysis Pipeline and visualised with WashU Epigenome Browser (v51.0.5). Datasets used: LNCaP - AR (GSE94682)65, H3K27ac (GSE73783)66, FOXA1 (GSE94682)65 and NR3C1/GR (GSE39880)67; A549 - H3K27ac (GSE29611)68, FOXA1 (GSE32465)69 and NR3C1/GR (GSE91313)68; MC7 - AR (GSE104399)70, H3K27ac (GSE94804)71, FOXA1 (GSE112969)72, and NR3C1/GR (GSE39879)67.
ChIP-qPCR
LNCaP, A549, and H1944 cells were grown in 15 cm plates to approximately 80 % confluency, before 4 h treatment with 10nM DHT or vehicle control. Cells were fixed with 4 % formalin and ChIP performed as previously published73. Antibodies used in overnight 4 °C immunoprecipitation were anti-AR (sc-7305, Santa Cruz Biotechnology, Santa Cruz, CA, USA) and rabbit mouse IgG at 10 mg per sample. After DNA isolation with phenol:chloroform:isoamyl alcohol and resuspension in water, enrichment across the two potential TMPRSS2 regulatory regions was quantified with qPCR (primers in Supplementary Table 1).
Immunohistochemistry
Lung samples from the above mouse studies were fixed in 4% formalin for 24 h, before transfer to 70% alcohol for storage before processing into wax. Sections were probed with anti-Tmprss2 antibody (ab92323, Abcam) and anti-AR (ab108341, Abcam) overnight at 4 °C at a 1/1000 dilution before detection with the Histostain- Plus IHC HRP Kit and DAB (Thermo Fisher).
Quantification of cell entry using pseudotyped virus
SARS-CoV-2 Spike protein pseudotyped lentiviral particles expressing luciferase were produced in 293T cells cultured in a 6-well plate. For this, 1 mg pCAGGS (GAG/POL), 1.5 mg pCSFLW (Luciferase) and 1 mg pcDNA3.1-SARS2-Spike were transfected into 293T cells using FugeneHD (Promega, Madison, WI, USA) at a ratio of 3 (lipid):1 (DNA) following manufacturer’s instructions. The lentiviral packaging constructs pCSFLW and pCAGGs-GAGPOL have been previously described74 and the codon-optimised pcDNA3.1-SARS2-Spike was a kind gift from Professor Robin Shattock (Imperial College London)75. After 5 h medium was changed and after another 72 h the medium supernatant was harvested and centrifuged. The titre of lentiviral particles was measured with a HIV-1 Gag p24 ELISA (Bio-Techne, Minneapolis, MI, USA) according to manufacturer’s protocol. A549 cells were grown in 48-well plates in full media ± 10 mM BIC or ENZA for 72 h prior to transduction with 3.75 x 104 TU per well. Cells were left for an additional 48 h and viral entry quantified using luciferase assay (E4030 Luciferase Assay System, Promega) according to manufacturer’s instructions. Luciferase activity was normalised to total protein content, quantified using a NanoDrop UV Spectrophotometer (Thermo Fisher).
SARS-CoV-2 live virus infection studies
A549 cells were seeded in 12-well plates and transiently transfected with 1ug of pCAGGS-ACE2 (synthesised by GeneArt, Thermo Fisher) using Lipofectamine 3000 reagent as described by the manufacturer (Thermo Fisher). After 24 h, cells were treated ± 10 mM bicalutamide or enzalutamide for 56-72 h. Cells were then washed with PBS and infected with SARS-CoV-2 virus. The viral strain used was SARS-CoV-2/England/IC19/202 (IC19)75. All work involving the use of live SARS CoV-2 virus was performed in a Containment Level 3 (CL3) laboratory (St Mary’s, Imperial College London).
The virus was diluted in serum-free DMEM (supplemented with 1 % NEAA and PS) to a multiplicity of infection (MOI) of 1. The inoculum was added to A549 cells overexpressing ACE2 and incubated at 37 oC for 1 hour. The inoculum was then removed and cells maintained as described above. 24 h post infection, the culture supernatants were collected and quantified by TCID50 assay on GMK Vero E6 cells as described previously 11. Serial dilutions of the virus (in serum-free DMEM) were added in 96-well plates and cells were left for 4-5 days before they were fixed with 2x crystal violet solution and analysed. TCID50 titres were determined by the Spearman-Karber method76.
Statistical Analyses
Statistical analyses were performed using GraphPad PRISM (v 6.0c). For experiments with 2 treatment arms, one-tailed T-tests were performed. For analysis of more than 2 treatments, one-way ANOVA was performed with Dunnett’s or Bonferroni’s multiple comparison tests. For comparison of AR and TMPRSS2 levels in the human lung (GTEx dataset), Wilcoxon tests were performed. All experiments were at least 3 independent repeats, unless otherwise stated.
DATA AVAILABILITY STATEMENT
For analysis of TMPRSS2 in different tissues, the GTEx dataset was used (https://www.gtexportal.org/home/). Transcriptomic analysis of gene expression was performed on datasets obtained from GEO: T47D cells treated with 10 nM DHT (GSE62243); data from lungs of castrated or intact mice (GSE31341). ChIP-Seq data was obtained from GEO: LNCaP - AR (GSE94682), H3K27ac (GSE73783), FOXA1 (GSE94682) and NR3C1/GR (GSE39880); A549 - H3K27ac (GSE29611), FOXA1 (GSE32465) and NR3C1/GR (GSE91313); MC7 - AR (GSE104399), H3K27ac (GSE94804), FOXA1 (GSE112969) and NR3C1/GR (GSE39879). sc-Seq - AR, TMPRSS2, and ACE2 expression were analysed using Eils Lab UCSC Cell browser (https://eils-lung.cells.ucsc.edu). Two additional single cell data sets were investigated (GSE122960). All the other data supporting the findings of this study are available within the article and its supplementary information files without any restrictions or from the corresponding author upon reasonable request.