Study Design
This current study was designed at the Institute of Basic Medical Science (IBMS) Peshawar, Khyber Teaching Hospital, Peshawar, Institute of Biotechnology and Genetic Engineering, Agriculture University Peshawar, Center of Applied and Molecular Biology Lahore. The study duration was 12 months (Jan 2018 to Feb 2019). The institutional ethical committee at the Institute of Basic Medical Science, Peshawar and Institutional Research and Ethical Review Board of Khyber Teaching Hospital approved the study.
Samples Collection and Processing
A total of 421 RNA positive samples (male: 207, female: 156) of chronic HCV infected individuals at Khyber Teaching hospital, Khyber medical college and Khyber medical university Peshawar, KP-Pakistan were selected. Questionnaire was taken from patients who came for HCV initial screening. Informed consent was taken from these patients. The patient responsive to treatment, patient’s not giving informed consent and cannot come for follow-up visits were excluded from study. After blood sampling, serum was stored in a refrigerator at -80 °C. A baseline investigation along with genotyping and viral load quantification was done. HCV RNA was detected using quantitative PCR (Q-PCR) according to the operating manual of the test kit (Qiagen, Germany) followed by HCV genotyping [36]. The routine LFTs were assessed for each patient in the hospital laboratory. Furthermore, biochemical tests (ALT, AST, bilirubin) were correlated with viral factors (genotype, viral load). The results were expressed as mean ± S.D (standard deviation) or as percentage. The correlation between categorical variables were assessed using the Chi Square, it was applied to evaluate differences in proportions using SPSS 20.0 software (SPSS Inc., USA). The P value (< 0.05) was labeled significant. HCV genotype determination was carried out as described earlier [36]. For HCV genotype determination, RNA extraction was carried according kit protocol. Isolated RNA was reverse transcribed into complementary DNA (cDNA). The cDNA was amplified in two rounds of type specific nested PCR for isolation of genotype specific PCR product.
Extraction of RNA
Viral RNA was extracted from HCV positive serum of genotype 3a. For extraction, RNA extraction was used as per kit protocol. RNA was immediately stored at -80oC for further analysis.
cDNA synthesis
Complementary DNA (cDNA) was synthesized (Invitrogen cDNA protocol kit) by RT PCR using reverse primers. Briefly, 04 µl RNA and 1 µl of Outer Antisense (OAS) primer was mixed and incubated at 65oC for 5 min and kept immediately on ice. Then 4 µl 5x buffer, 2 µl 10 mM dNTP’s, 1 µl RNAase inhibitor and 1 µl reverse transcriptase enzyme was added to a final volume of 15 µl. Mixture was kept in thermal cycler at 42oC for 60 minutes and then termination of reaction at 70oC for 10 minutes.
Conventional PCR for Core Gene Detection
For amplification of HCV Core gene, forward (5’ATGAGCACACTTCCTAAACC3’) and reverse primers (5’GACGTATTCCGCCACTCTAG3’) were used for amplification. PCR was done in a total reaction volume of 15 µl including 2 µl of cDNA, reverse primer 1 µl, forward primer 1 µl, Master mix (Invitrogen) 7.5 µl and distilled water 3.5 µl. Mixture was kept in the thermal cycler and the temperature was set for initial denaturation at 95oC for 5 min, and then 36 cycles each consisting of denaturation at 95oC for 0.25 sec, annealing done at 55oC for 30 sec and elongation at 72oC for 1 min. Final extension was carried out at 72oC for 10 min.
Gel electrophoresis
The amplified gene specific PCR product (573 bp) was resolved on 1.5% agarose gel (Thermo Fisher Scientific, USA). By using a 100 bp DNA ladder (Fermentas, USA) It was visualized under UV illumination. (Uvitec Limited, Cambridge, UK). The confirmed PCR product was eluted by protocol of kit (Novel Gel/PCR DNA Purification Mini Kit)
Sequencing and Cloning of Core gene
Amplification
For molecular genomic analysis, one sample with high viral titer was selected for isolation and amplification of structural gene. The amplified, sequenced purified PCR product was cloned in pDNA2.1 TA cloning Kit (TOPO TA Cloning Kit Lot no 1506821-invitrogen)
Primer Designing
For amplification of core gene from plasmid both forward (GCGATATCATGAGCACACTTCCTAAA) and reverse (AATCTAGATCATGGCTGCTGGATGAAT) primers were designed. For cloning, primers had restriction sites for EcoRV and Xba1. In all the primers, the start codon was present in the Flag TAG sequence and a stop codon for translation termination was incorporated. The PCR positive clones were used for further confirmation analysis by restriction digestion of the plasmid containing core gene.
Cloning in mammalian expression vector pcDNA3.1
The amplified PCR product was cloned into mammalian expression vector pcDNA3.1. By continuous heat shock, ligation product was transformed into DH5α E Coli (competent cells) Transformed cells were allowed to proliferate for 120 min and incubated at 370C with shaking. A total of 0.2 ml of the growth medium was spread on fresh LB/AMP and Kanamycin plates. Transformed colonies appeared blue and white after overnight incubation at 370C. Confirmed clone was sequenced with Big Dye Deoxy Terminator method using vector specific universal outer sense and inner sense primers (UOS, UIS) followed by bidirectional sequencing in DNA sequence (Applied Biosystems).
Collection and extraction of medicinal plant
The leaves of Indigoferra gerardiana (IG) were collected from northern area of KPK, confirmed by the Botany department of Peshawar university. The leaves were shade dried, segregated and crushed in grinder to form coarse powder. Methanol was added at the ratio of 1:20 (w/v) and was macerated for 72hrs. Whartsman filter paper (no-1/ cloth filter) was used for the filtration of supernatant. The solvent was evaporated using a vacuum rotary evaporator (Heidoloph Rotavapor) under controlled temperature (40 °C) and reduced pressure (204 mbar). Double extractions was done for the collection of residue [37]. Methanolic extract was further fractionized on the basis of polarity, in n-hexane, chloroform and acetone. The results revealed that viral titer was blocked by acetone extract to a greater extent.
Stock solution preparation
The dried plant extract (100 mg) was suspended in 01 ml of Dimethylsulfoxide (DMSO) for stock concentration (100 mg/ml). Then make dilutions in 5% DMSO (5 ml DMSO + 95 ml H2O) inside the laminar flow hood sieving (by using 0.22 um filter) done of the above solution and stored at (-20 °C).
Cell lines
The Huh-7 cell line (University of Lahore) was cultured in Dulbecco’s modified Eagle medium (DMEM). It was supplemented with 100 µg/ml streptomycin, fetal bovine serum (10%) and penicillin (100iu/ml) at 37 °C in an atmosphere of CO2 (5%).
MTT Assay for Toxicity
Toxicological effect was determined through MTT assay. In living cells, the MTT substance is reduced to purple formazan crystals (insoluble in water) by mitochondrial succinic dehydrogenases. The absorption of dissolved formazan correlates with the number of alive cells. To determine the cellular toxicity, different concentrations of herbal extract was added into 96-well plates (2 × 104 cells/well), the plate was incubated (37 °C) in an atmosphere of CO2 (5%) and sealed in aluminum foil for 24hrs. At end of extraction, test compounds and media were removed. 20 µl of MTT solution (5 mg/ml in PBS) and fresh media (100 µl) were added to all wells. The plate was wrapped in aluminum foil and then it was incubated at 37 °C for 04 hours. DMSO of 100 µl was added to dissolve the formazan crystals after media was removed. MTT-formazan product was accessed by measuring absorbance-reader at a test wavelength of 570 nm by Enzyme Linked Immunosorbent Assay (ELISA) plate.
Analysis of plant extracts in cell line
To establish, in-vitro replication of HCV, -Huh-7 cell line was used. The same protocol was used for viral inoculation as done by Rehman S in 2011. In these experiments, HCV patients of 3a genotype with high viral titer > 1 × 109iu/ml was used as inoculums. Huh-7 cells were maintained in six well culture plates and washed two times with serum-free medium. Different concentrations of drug containing medium was added to the cell culture replaced after every 24 h. after incubation at 370C for 48 h, DMEM containing MTT at the final concentration of 1 mg/ml was added to each well, after 1 h of it was replaced with 100 ul of DMSO to solubilize the formazan crystals. Using spectrophotometer, the surviving cells of each well were measured at 570 nm by optical density (OD) (30). Transfected cells were maintained in 5% CO2 for 24 h at 37 °C. On next day, adherent cells were washed 03 times with 1 × PBS buffer, medium was added and again incubated for 48 hrs. Cells were harvested and assessed by RT-PCR. To analyze the effect of medicinal plant extracts on HCV, transfected Huh-7 cells were seeded after 02 days of infection in 24 well plates in both absence and presence of herbal extracts which were then grown to 80 percent confluence. The cells viability was noted after 24hrs. Cells were then lysed by cell lysis solution containing 5 µl internal control (Sacace, Italy). RNA pallet was solubilized in 1% DEPC (Diethyl Pyro Carbonate) treated water. HCV RNA quantifications were determined by RT-PCR using kit protocol.
Effect of IG extract on gene expression in cell line through Real Time PCR
The anti-viral effect of plant extract on HCV core gene were detected by using specific-primers of HCV core genes via quantitative PCR (Fermentas, USA). The GAPDH gene was used ror internal control. Each RT PCR assay was performed in triplicate.
Components and concentrations of PCR reaction
To analyzed the anti-viral effect of plant extract on HCV core gene, from transfected Huh-7 cells. Semi-quantitative RT PCR product was amplified by using forward and reverse primers of the GAPDH and primer of the HCV Core gene under controlled condition. The PCR products were subjected to electrophoresis. Briefly, reagents of PCR were; PCR product-2ul, 10xPCR buffer 2.5 ul, Mgcl2-2ul, dNTPs (10 mM) 2 ul.core, outer reverse primer 1 ul, core inner forward primer 1.0 ul and Taq polymerase-1.0 ul, dist water was added to reaction mixture to make volume up to 20 ul.