Cells and viruses
The SARS-CoV-2/Korea/KCDC03/2020 virus, isolated by the Korean Center for Disease Control, was used in the experiment. Vero E6 cells were first inoculated with the viruses and cultured for four days. The culture medium was then centrifuged, aliquoted, and stored at − 70 °C, and the virus titers were measured using a plaque assay. Viral culture was performed in a biosafety level (BSL)-3 laboratory.
Extraction of viral RNA
RNA was extracted from the culture medium using a QIAamp viral RNA mini kit (QIAGEN, Hilden, Germany) according to the manufacturer’s instructions. Viral lysis was performed in a BSL-3 laboratory, whereas procedures involving RNA were performed in a BSL-2 laboratory. We extracted RNA from 140 µL of the sample using Qiagen viral RNA mini kits, in accordance with the manufacturer’s instructions.
Real-time RT-PCR for SARS-CoV-2
Information regarding the primers provided by the WHO and used in real-time RT-PCR [2] is shown in Table 1. AgPath-ID™ one-step RT-PCR reagents (Applied Biosystems, Foster City, CA, USA) were used in accordance with the manufacturer’s instructions. One microliter of the primers (10 pmol) and 0.5 µL of probes (10 pmol) were added to the reagents. Primer/probe sets for detecting the RdRp and E genes were added to different tubes. The RNA sample (5 µL) was mixed with the PCR mixture, and PCR was performed at 50 °C for 30 min, 95 °C for 10 min, 95 °C for 15 s, and 60 °C for one min, for 40 cycles; ROX (carboxyrhodamine) was used as a passive reference dye. The Applied Biosystems™ 7500 Fast Real-Time PCR System was used for real-time RT-PCR with the extracted RNA, and the cycle threshold (Ct) value of the SARS-CoV-2 target gene was ascertained (Table 1).
Table 1
Primers and probes in this study for detection of SARS-CoV 2
|
Primer/Probe
|
Sequence (5’–3’)
|
RdRp gene
|
RdRp_SARSr-F2
|
GTGARATGGTCATGTGTGGCGG
|
RdRp_SARSr-R1
|
CARATGTTAAASACACTATTAGCATA
|
RdRp_SARSr-P2
|
FAM-CAGGTGGAACCTCATCAGGAGATGC-BHQ
|
E gene
|
E_Sarbeco_F1
|
ACAGGTACGTTAATAGTTAATAGCGT
|
E_Sarbeco_R2
|
ATATTGCAGCAGTACGCACACA
|
E_Sarbeco_P1
|
FAM-ACACTAGCCATCCTTACTGCGCTTCG-BHQ
|
R is G/A; FAM, 6-carboxyfluorescein; BHQ, black hole quencher |
Determination of specificity and sensitivity
To assess the specificity of real-time RT-PCR, 23 virus strains—human coronavirus 229E, NL63, OC43, HKU1, MERS-CoV, influenza virus A/H1N1pdm09, A/H3N2, B, adenovirus type 5, rhinovirus, parainfluenza virus 1/2/3, respiratory syncytial virus A/B, metapneumovirus, bocavirus, measles virus, mumps virus, rubella virus, enterovirus, varicella-zoster virus, and hantavirus (Table 2)—and five samples showing negative results for a known respiratory virus were used. Sensitivity was measured by real-time RT-PCR using plasmids containing the target genes, which were diluted 10-fold from different initial concentrations. To examine the responsivity of the assay to RNA, RT-PCR was performed using 10-fold diluted RNA extracted from a lower respiratory tract sample of the first patient who tested positive for COVID-19 in South Korea.
Table 2
COVID-19 Nucleic detection kit EUA approved in ROK
Product name
|
Approval Date
|
Target gene
|
Manufacture
|
PowerCheckTM2019-nCoV
|
2. 4. 2020
|
RdRp, E
|
Kogenbiotech
|
AllplexTM2019-nCoVAssay
|
2.12. 2020
|
RdRp, E, N
|
Seegene
|
DiaPlexQTMNovel Coronavirus (2019-nCoV) Detection kit
|
2.27. 2020
|
ORF1a, N
|
Solgent
|
STANDARD M nCoV Real-Time Detection kit
|
2.27. 2020
|
RdRp, E
|
SD biosenser
|
Real-Q 2019-nCoV Detection kit
|
3.13. 2020
|
RdRp, E
|
Bioseum
|
Plaque assay for virus titration
Vero E6 cells were seeded into 12-well plates at 2.0 × 105 cells per well. After 24 h, these cells were infected with 50 µL of 10-fold serial dilutions of the virus samples, and incubated for 1 h to facilitate viral adsorption. The cells were then covered with a basal MEM-α agar overlay containing 0.02% (w/v) diethylaminoethyl-dextran, 0.1% (w/v) glucose, 0.7% (w/v) SeaKem® LE Agarose (LONZA, Basel, Switzerland), 30 mM MgSO4, and 4 µg/mL trypsin (Gibco, Grand Island, NY, USA). The cells were incubated at 37 °C for three days to facilitate infection. Two days after viral infection, a 0.03% (w/v) crystal violet overlay was added to each well to stain viable cells.
Determination of intra-assay and inter-assay reproducibility and efficiency
To determine the limit of detection (LOD), the titers of the isolated viruses were measured in plaque-forming units (PFU). The virus culture medium was diluted from 3.45 × 106 PFU/mL to 1 × 105 PFU/mL. Ten-fold dilutions of the medium were prepared until a concentration of 1 × 10− 2 PFU/mL was obtained. RNA was extracted from each diluent and used for real-time RT-PCR. The RdRp and E genes were targeted for detection. Real-time RT-PCR was performed in triplicate to assess the assay reproducibility. The assay was repeated three days later, using RNA extracted from the diluted virus culture media to assess repeatability.
Determination of accuracy of EUA reagents
To investigate the accuracy of the COVID-19 EUA-approved reagents in the Republic of Korea (Table 2), 55 positive samples (selected five-step positive samples based on the distribution of Ct values of the RdRp gene) and 50 negative samples were used to confirm the matching rate (sensitivity and specificity) of the results between the methods used in this study and each EUA product.
Statistical analysis
Inter-assay and intra-assay variations in the Ct value were determined for the triplicate real-time RT-PCR reactions and for the repeat assay three days later. The reliability of each experiment was determined from the F and P values.