2.1 materials
The cell culture medium DMEM, fetal bovine serum (FBS), Penicillin-Streptomycin and 0.25% trypsin-EDTA were purchased from Gibco (Thermo Fisher Scientific, Inc., Waltham, MA, USA). LPS-EK Ultrapure was purchased from invivogen. Antibodies directed against HO-1 (ab85309), COX-2 (ab62331), as well as HRP-conjugated secondary antibodies (ab6721) were purchased from abcam. Lamin B1 (12987-1-AP), α-tubulin (14555-1-AP), were purchased from ProteinTech. Antibodies directed against iNOS (13120S), protein kinase B (Akt; 4685S), p-Akt (4060S), NF-κB (8242S), NFAT1 (4389S), β-actin (4967S), and MAPKs [P38, 8690S; phospho-P38, 4511S; JNK, 9252S; phospho-JNK, 4668S; ERK, 4695S; phospho-ERK, 4370S], were purchased from Cell Signaling Technology, Inc., (Danvers, MA, United States).
2.2 strain identification
The strain of actinomycete was isolated from the sediment samples of Mai Po mangroves, Hongkong, China and grown on R2A agar (#218263, BD difco). This strain was identified as Streptomyces ssp. based on phylogenetic analysis of 16S rRNA gene sequence using primers 8F (5-AGAGTTTGATCCTGGCTCA-3) and 1942R (5-GGTTACCTTGTTACGACTT-3).
2.3 strain fermentation and extraction
This Streptomyces was activate on R2A agar first, then inoculated and cultured in 50 mL Centrifuge tube containing 15 mL culture medium (starch 5.0 g, glucose 5.0 g, tryptone 1.0 g, yeast extract 1.0 g, peptone 1.0 g, seasalt 17.0 g in 1L Deionized water, ph 7.0), incubated on a rotary shaker (200 rev/min) at 28˚C for 1 days. 4 mL of this seed culture was inoculated into 250 mL Erlenmeyer flasks containing 80 mL culture medium, incubated at 28˚C with shaking (200 rpm) for 4 days. The cell culture medium was centrifuged at 10,000× g for 15 min to remove precipitates and use filter paper to separate the mycelia. The supernatant was mixed with triple volume of ethyl acetate and then the aqueous and ethyl acetate phases was separated. The ethyl acetate layer was evaporated under a rotary evaporator (Heidoloph) to obtain crude extract R31 crude extract which was redissolved in DMSO.
2.4 cell culture
The murine macrophage cell line RAW264.7 was purchased from American Type Culture Collection (Manassas, VA, USA). Cells were cultured in DMEM supplemented with 10% heat-inactivated foetal bovine serum (FBS), and 1% penicillin-streptomycin at 37˚C in a 5% CO2 humidified atmosphere.
2.5 cytotoxicity assay
The cell viability was measured by using the Cell counting kit-8 assay (DOJINDO). Briefly, RAW24.7 cells were seeded into 24-well plates at a density of 5 x 105 cells per well for 24 h and treated with various concentrations of R31 crude extract (5, 10, 15, 20, 25 µg/ml ) or co-treated with LPS (1 µg/ml) for another 24 h at 37˚C. Thereafter, we replaced the supernatants for new medium and CCK-8 solution (100 µl/ml ) was added to each well, the cells were cultured for another 30 min at 37°C. Finally, the 24-well plates was measured at 450nm absorbance by a microplate reader (Benchmark plus Bio-Rad Laboratories, CA, USA).
2.6 measurement of nitrite concentration
To measure nitrite, the cells were pretreated with R31 crude extract followed by LPS stimulation as described above. Cells were treated with or without R31 crude extract in the presence or absence of LPS for 24 h. 100-µl cell-free supernatants were collected and mixing with the Griess reagent which containing equal volumes of 1% sulfanilamide in 2.5% H3PO4 with 0.1% N-(1-naphthyl)- ethylenediamine dihydrochloride. Each sample was assayed in duplicate. Nitrite content was measured by absorbance at 540nm with a microplate reader (Benchmark plus Bio-Rad Laboratories, CA, USA).
2.7 RNA-sequencing and function enrichment analysis
The samples of control, R31 crude extract (25 µg/ml) group both with or without LPS (1 µg/ml) were sent to Beijing Genomics Institute (BGI, Shenzhen, China) for RNA extraction, cDNA library construction and sequencing on DNBSEQ platform, generating an average of 45.57 M reads of 150 bp per sample. Adapter and low quanlity reads (N > 5%, Q < 10) were removed by SOAPnuke v1.5.2. Differentially expressed genes (DEGs) between the sample groups were screened out from normalized TPM values, |log2 (fold change)| ≥1 and P-value ≤ 0.05. VENN diagram is constructed by Dr.TOM (BGI) system to show the numbers of DEGs between the groups, then the Heat Maps, Gene Ontology (GO) and Kyoto Encyclopedia of Genes and Genomes (KEGG) analysis were performed base on these DEGs.
2.8 quantitative realtimepolymerase chain reaction (qRTPCR)
RAW264.7 cells were seeded into a 6-well plates overnight and treated with R31 crude extract (25 µg/ml) and LPS for 4 h at 37˚C. Total cellular RNA was isolated using AxyPrep™ Multisource Total RNA Miniprep Kit (Axygen, Corning Inc., NY, USA) according to the manufacturer’s instructions. RNA concentrations were determined by NanoDrop ND1000. From each sample group, total RNA (1 µg) was reverse-transcribed to obtain cDNA using PrimeScript™ RT reagent Kit with gDNA Eraser (RR047A, Takara, Japan). Real-time PCR was performed by using QuantStudio 3 Real-Time PCR Systems (Applied Biosystems) and TB Green® Premix Ex Taq™ II (RR820A, Takara, Japan). Relative fold change of target mRNA were determined using the comparative cycle threshold (ΔΔCT) method by normalizing target mRNA Ct values to those for β-actin (Ct). The qRT-PCR reaction conditions were as follows: 95°C for 30 s, followed by 40 cycles of 95°C for 5 s, 60°C for 30 s. In addition, a melting curve analysis was carried out to verify non-specific signals. Each sample was performed in triplicate. Primer sequences for qPCR of iNOS, COX-2, HO-1 and β-actin mRNA are shown in Table 1.
Table 1
Name and sequence of primers used for reverse transcription-quantitative polymerase chain reaction.
Gene name
|
Primer sequence (5'-3')
|
Gene ID
|
Product size (bp)
|
Inducible nitric oxide synthase
|
F: GGCACCGAGATTGGAGTTC
R: GGTCACATTCTGCTTCT
|
NM001313921
|
174
|
Cyclooxygenase-2
|
F: TCAGGTCATTGGTGGAGAGG
R: ATGGTGGCATACATCATCAGAC
|
NM011198.4
|
150
|
Heme oxygenase-1
|
F: AGGTCCTGAAGAAGATTGC
R: TCTCCAGAGTGTTCATTCG
|
NM010442.2
|
175
|
β-actin
|
F: GCACCACACCTTCTACAA
R TACGACCAGAGGCATACA
|
NM007393.5
|
156
|
F, forward; R, reverse.
|
2.9 measurement of IL-1, IL-6, IL-10 and TNF-α concentration
To detect the cytokine production, the cells were pretreated with different concentrations of R31 crude extract (5–25 µg/ml) for 30 min (37˚C) and stimulated by LPS (1 µg/ml) for 24 h at 37˚C. The levels of IL-1, IL-6, IL-10 and TNF-α in the culture media was measured by an enzyme-linked immunosorbent assay (ELISA) kit (Invitrogen, Thermo Fisher Scientific, Inc., Waltham, MA, USA) according to the manufacturer’s instructions.
2.10 preparation of nuclear extract
The RAW264.7 cells were treated with R31 crude extract (25 µg/ml) followed by stimulated with LPS for 30 min at 37˚C. The cells were washed three times with cold PBS and use the extraction of cytoplasmic and nuclear protein with the kit (#P0027, Beyond time, Shanghai, China) to obtain the cytoplasmic and nuclear proteins and then stored at -80◦C.
2.11 western blot analysis
RAW264.7 cells were seeded into a 6-well plates overnight and treated with R31 crude extract (25 µg/ml) and LPS for 15 min at 37˚C. Then the cells were harvested by using an ice-cold RIPA buffer (Beyotime) containing protease and phosphatase inhibitor (#539134, #524629, Millipore, Billerica, MA, USA). Protein concentrations of the cell lysates were determined by using the BCA protein assay reagent (Beyotime) according to the manufacturer’s instructions. Total proteins of each sample (20 µg) were separated by 10% SDS-PAGE gels and transferred to PVDF membrane (#IPVH00010, Merck Millipore). After blocking with 5% non-fat milk in Tris-buffered saline (TBS) containing 0.1% Tween-20 (TBST) at room temperature for 1 h, the membranes were incubated with primary antibodies directed against p-p38, p38 (1:1,000), p-ERK, ERK (1:1,000), p-JNK, JNK (1:1,000), p-Akt, Akt (1:1,000), HO-1 (1:1,000), iNOS (1:1000), COX-2 (1:1,000), NFAT1 (1:1,000), NF-κB p65 (1:1,000), Lamin B1 (1:1,000), α-tubulin (1:1,000), and β-actin (1:1,000) overnight at 4°C. The PVDF membranes were washed with TBST and incubated with horseradish peroxidase (HRP)- conjugated secondary antibody (1:5000) for 1 h at room temperature. Lamin B1 /α-tubulin/ β-actin was used as the loading control for each lane. After washing with TBST, target signals were visualized by ECL (#32106, Thermo Fisher Scientific) detection and analyzed with a gel imaging software.
2.12 statistical analysis
All experiments were performed at least three times. The data were expressed as the mean ± standard deviation (SD). Statistical analysis was performed using the Statistical Package for GraphPad Prism software (version 16.0) to determine significant differences between the sample groups. We also used either a Student's t-test or one-way analysis of variance followed by Dunnett’s multiple comparisons test for analyses. P-values of less than 0.05 was considered to indicate a statistically significant.