Patients
Thirteen members of a large Brazilian family were studied. This family was previously screened for genes associated to cancer, including SDHA, SDHB, SDHC, SDHD, BRAF, JUNB, CDKN1B and PTEN (18). In this study, only members without thyroid problems and older than 40 years old were treated as unaffected. All patients were recruited under protocols approved by the Institutional Review Board of the participating institutions and written informed consent was obtained from all participants.
Clinical and DNA studies
The sampling of epithelial buccal cells was performed as previously described (19). After the collection, 10µl of proteinase K (20mg/mL) were added to the solution, being left overnight at 65ºC, DNA was purified by adding ammonium acetate 10M, precipitated with isopropanol and resuspended with 50µl of Tris 10mM (pH 7.6) and EDTA 1mM. Exome sequencing was conducted as we have described elsewhere (20, 21). In brief, exome DNA was captured using a SureSelect Human all exome v6 (Agilent Technologies, USA). The 150-bp library was sequenced paired end on the NovaSeq6000 platform (Illumina), and read alignment was done against the human chromosome reference assembly build 37 (GRCh37, NCBI). Filtering and analysis of the variant calling files was performed using the VarSeq v2.2.2 (Golden Helix Inc., Bozeman, MT) using the hereditary gene panel with modifications adjusted to our studied pedigree. The identified USP13 genetic variant was confirmed through Sanger sequencing in all members of the family carrying it based on the exome sequencing findings.
In silico analyses
Genetic variants were evaluated by MutationTaster (http://www.mutationtaster.org/), Polymorphism Phenotyping v2 algorithm tool (PolyPhen-2) (http://genetics.bwh.harvard.edu/pph2), SIFT (Sorting Tolerant From Intolerant) algorithm (http://sift.jcvi.org), Mutation Assessor (http://mutationassessor.org/r3), FATHMM (Functional Analysis through Hidden Markov Models v2.3) (http://fathmm.biocompute.org.uk/) and FATHMM MKL (http://fathmm.biocompute.org.uk/fathmmMKL.htm) to predict the possible impact of the amino acid substitution on the structure and function of the corresponding proteins. Variants that were predicted as damaging by more than four in silico tools and also have a frequency in gnomAD less than 1% were selected for further studies.
Ab initio Modeling
I-Tasser was used for the ab initio modeling of the native (wild type) and the mutated USP13 deduced amino acid sequences of p.V495M (http://zhanglab.ccmb.med.umich.edu/I-TASSER) (9–11). Predicted models were evaluated for discrete optimized protein energy and root mean square distance (RMSD) score (for the measurement of the average distance between the backbones of the superimposed proteins), and the TM score (to assess topological similarity) was calculated using TM-Align (22–24). The chosen 3-dimensional structures of the native and the mutated structures were further analyzed using PyMOL molecular graphics system (DeLano Scientific; http://pymol.sourceforge.net/).
In vitro Functional Characterization
Cell culture
MDA-T32 thyroid cancer cells were acquired from ATCC (CLR-3351) grown in RPMI-1640 medium containing GlutaMAX™ (72400146, Thermo Fisher, MA, USA) supplemented with 10% fetal bovine serum (100–106, Gemini Bio Products, CA, USA), and 1% antibiotic (Penicillin-Streptomycin – 15140-148, Gibco, TX, USA). Cells were incubated in a humidified atmosphere at 37ºC with 5% CO2.
USP13 siRNA
USP13 siRNA was performed in MDA-T32 cells following manufacturer’s protocol. We used Human USP13 on-target plus smart pool siRNA (L-006064-00-0010, Dharmacon, CO, USA) and non-targeting on-target plus control pool (D-001810-10-05, Dharmacon, CO, USA). Briefly, 3x104 MDA-T32 cells were plated in 12 well plates. The next day, cells were transfected with 1µM of siRNA or control and incubated for 24h. Medium was replaced by fresh medium for more 24 hours and cells were collected for protein extraction.
Site directed mutagenesis
The human USP13 wild type (NM_003940) coding sequence was cloned into the pCMV6-Entry vector with C-terminal Myc-DDK tag (RC202190, Origene, Rockville, MD, USA). The p.V495M variant was introduced into the human USP13 wild type template using the QuikChange Lightning Site-directed Mutagenesis Kit (210518-5, Agilent Technologies, Santa Clara, CA, USA), following the manufacturer’s protocol. Insertion of the variant was confirmed by Sanger sequencing. The following mutagenic primers were used:
USP13-Val495Met MUT _F: GCATCAGGTAATCCATCCTCTCCGTGTAGCG
USP13-Val495Met MUT_R: CGCTACACGGAGAGGATGGATTACCTGATGC
Cycloheximide chase assay
MDA-T32 cells were seeded into 12-well plates at a density of 3x104 cells per well. After 24h of incubation, cells were transfected with Effectene Transfection Reagent (301425, Qiagen, Germany) following manufacturer’s protocol. 0.5µg of each vector (USP13 wild type and USP13 p.V495M variant was used for the transfection. The empty pCMV6-Entry vector was used as a negative control. After 24h of transfection, medium was removed, cells were treated with 25µM of cycloheximide (MilliporeSigma, 01810) and incubated for 3, 8 and 24 hours. After each incubation time, cells were washed with PBS and protein was extracted. Experiment was performed in triplicate.
Analysis of protein expression
Cells seeded in 12 wells plate were resuspended in 35µl of ice-cold lysis buffer (Tris-HCl 10mM, pH 7,5, NaCl 150mM, EDTA 1mM, EGTA 1mM, SDS 0.1%, Nonidet P-40 1%) containing a cocktail of protease and phosphatase inhibitors (Sigma-Aldrich PPC1010). The collected cells were incubated for 30 minutes on ice and then centrifuged for 15 minutes at 4ºC, 13000 rpm. Total protein concentration of supernatant was determined by Pierce™ BCA Protein Assay (23227, Thermo Scientific, MA, USA), following the manufacturer's protocol. After quantification of protein extracts, 20µg of total proteins of each sample were separated by electrophoresis in 10% polyacrylamide gel under denaturing conditions (SDS-PAGE). Proteins were then transferred to a nitrocellulose membrane (BioRad) and Western Blot was performed using antibodies against PTEN diluted 1:1000 (SC-25778, Santa Cruz Biotechnology, TX, USA), c-DDK diluted 1:1000 (TA50011-100, Origene, MD, USA), GAPDH diluted 1:2000 (SC-25778, Santa Cruz Biotechnology, TX, USA) and GAPDH diluted 1:2000 (SC-47724, Santa Cruz Biotechnology, TX, USA). Fluorescent secondary antibodies (827–08364 IRDye 800CW Goat anti-Mouse and 926-68073 IRDye 680RD Donkey anti Rabbit, LiCor, USA) diluted 1:20000 and Odyssey CLx Imaging System (Licor, USA) were used to acquire the signal of the bands. Densitometric quantification was performed using ImageJ software and a ratio between protein of interest and GAPDH was calculated and ploted on GraphPad.
Clonogenic survival assay
1x103 MDA-T32 cells/well were seeded in six well plates for 24h and transfected with empty vector (p.CMV6), USP13 wild type and USP13 p.V495M, as described above, for 48h. After incubation time, the cell culture medium was removed, and fresh medium was added. Cells were then incubated for 7 days and medium was changed every two days. In the end point of the experiment, medium was removed, and colonies were fixed with a solution containing 0.05% w/v of crystal violet, 1% of formaldehyde and 1% methanol in PBS. Fixed colonies were photographed at a magnification of 4x. One milliliter of acetic acid 10% was added to each well and plates were shaken for 15 minutes to discolor the plaque. 200mL of the violet stain solution removed from the plate was transferred to a 96-well plate and read on a spectrophotometer at an absorbance of 590nm. The intensity of staining is proportional to the number of colonies established after treatment. Experiment was performed in triplicate.
Cell viability assay
MDA-T32 cells were seeded into 96-well plates at a density of 4x103 cells per well and incubated for 24h. Cells were then transfected with the non-target control or siRNA as described above and incubated for 0, 24, 48 and 72 hours. At each time point, MTT (3-(4,5-dimethylthiazol-2-yl)-2,5-diphenyltetrazolium salt) was added to a final concentration of 0.5mg/mL into the culture media. After 3h of incubation with MTT, medium was removed and 200mL of isopropanol containing acetic acid 0.04M was added into the wells and plate was gently shaken to solubilize the product reduced by MTT. Absorbance was measured at 570nm.
Statistical analysis
Statistical analysis was performed using Student’s t-test or One-way ANOVA with multiple comparisons tool. Data are expressed as mean ± SEM. Differences between mean values were considered significant when p < 0.05.