Tissue samples
Tumor tissue samples were obtained from 18 patients with primary osteosarcoma who received a histopathological diagnosis and underwent surgical resection for osteosarcoma at the department of orthopedics and pediatric surgery of our hospital from March 2018 to October 2019 were collected. We excluded patients with a prior diagnosis of tumors of other organs and patients with serious diseases of heart, lung and other organs. The tissue parts surrounding the tumor, which was not diagnosed as cancer tissue, from the same patient was collected as normal control. This study was approved by the Institutional Ethics Review Board of Huanggang Central Hospital. Written informed consent was obtained from all the patients. Tissue samples were collected at surgery, immediately frozen in liquid nitrogen and stored until analysis in the present study.
Cell lines and main reagents
Human osteosarcoma MG63 and normal osteoblast hFOB cell lines were purchased from the Cell Bank Type Culture Collection of the Chinese Academy of Sciences (Shanghai, China). Dulbecco’s modified Eagle’s medium-F12 (DMEM/F12) was purchased from Hyclone, USA; Fetal Bovine Serum (FBS), Penicillin-streptomycin (100 U/mL) were purchased from Hangzhou Sijiqing Biological Company; RIPA Lysis buffer, BCA Protein Quantification Reagent Kit were purchased from Invitrogen, USA; Opti-MEM (Gbico, UK); Anti-Tim–3 monoclonal antibody was obtained from BD Bioscience, USA; Rabbit anti-E-Cadherin, N-cadherin, Vimentin, and GAPDH monoclonal antibodies were purchased from Abcam, USA; Rabbit anti-CD9, CD81, and CD63 monoclonal antibodies were purchased from Santa Cruz, USA; Horseradish peroxidase (HRP) labeled goat anti-rabbit IgG secondary antibody was purchased from Guangzhou Jingcai; PKH67 green fluorescent cell linker dye, and PMA were purchased from Sigma Company, USA.
Cell culture and transfection
After resuscitation of osteosarcoma cell lines MG63 and hFOB, the cells were cultured in DMEM/F12 medium supplemented with 10% FBS and 1% of penicillin-streptomycin at 37 °C in a humidified incubator with 5% CO2. When the cells reached 70%–80% confluence, the cells were digested with 0.25% trypsin and centrifuged at 800 r/min for 5 min at room temperature (RT). The supernatant was discarded, and the cells were resuspended with DMEM/F12 for passage.
The MG63 cells (2×105 cells/well) at the logarithmic growth stage were seeded onto a 6-well plate and incubated overnight. MG63 cells were transfected with 30 ng of Tim–3 sgRNA, Cas9 plasmid or negative control (NC) sequence (Guangzhou Ruibo Biological Company) using Transfection reagent Lipofectamine 3000 (Invitrogen, USA) following the manufacturer’s instructions. After transfection for 6 h, the medium was replaced with DMEM/F12 medium containing 10% FBS and incubated in a humidified atmosphere of 5% CO2 at 37 °C. 48 h after transfection, cells were collected for the downstream experiments. The experiments were repeated three times. The required macrophages in the experiment were obtained by treating about 1×106 THP–1 cells with 50 ng/mL PMA for 48 h.
Isolation and identification of exosomes
MG63 and hFOB cells at 80%~90% confluence were pelleted and washed thrice with DMEM/F12 media, followed by replacement of media with fresh DMEM/F12 containing 10% FBS and the cells were cultured for additional 72 h at 37 °C in a 5% CO2 atmosphere before harvesting exosomes. The cell culture medium was collected and intact cells and cell debris were removed and exosomes were isolated by differential centrifugation at 300×g for 10 min, and 2,000×g for 10 min, 1,000×g for 30 min, respectively. The resulting pellet was resuspended, washed once in ice-cold PBS, and filtered through sterile 0.22 μm (pore-size) syringe filter and repelleted at 1,000,000 g for 70 min at 4 °C. The pellet containing exosomes was washed and resuspended in ice-cold PBS and stored at –80 °C.
For Transmission Electron Microscopy (TEM), freshly prepared osteosarcoma-exosomes (2 L) were diluted in 20 L PBS, fixed with 3.5% paraformaldehyde, then, exosome preparation was allowed to adsorb in the mesh copper grid. The resulting grids were rinsed twice with wash buffer and contrasted by uranyl-oxalate solution at pH 7 for 5 min. The TEM visualizations of exosomes morphology were performed using a Hitachi H–9000 transmission electron microscope at 300 kV and images were acquired using a slow-scan CCD camera. Size profiles of isolated exosomes were determined by the Nanosight size analyzer. Briefly, 50 L of exosomes was diluted in PBS to a final volume of 1 ml and filtered through a 0.22 μm filter membrane. Size curves were determined by nanoparticle tracking analysis using a Nanosight NS300TM. Three video recordings of 40 sec were carried out for each preparation. NTA 3.2 software version was used to record and analyze the videos. The expression of exosome characteristic proteins including CD9, CD81, and CD63 was detected using Western blot assay.
Labeling and tracking of exosomes
The extracted and purified exosomes were collected and labeled KPH67 reagent according to the manufacturer’s instructions. The nuclei of macrophages were counter-stained with DAPI dye following the manufacturer’s instructions. KPH67 labeled exosomes were added to DAPI stained macrophages and co-cultured at 37 °C in a humidified atmosphere of 5% CO2 for 12 h. After incubation, the exosomes were analyzed by a fluorescence confocal microscope.
Cell migration and invasion
The cell invasion assay was carried out using 24-well transwell chambers with 6.5 mm diameter polycarbonate filters (8 µm pore size, Corning, NY, USA) coated with 35 μL Matrigel (Becton, Dickinson and Company, USA). Cells were seeded in the upper chambers at a density of 5×104 cells/well and then treated with different concentrations of Anlotinib (0, 2, 4, 8 μmol/L), and allowed to invade for 24 h toward the lower chamber containing 10% FBS containing 10% FBS or serum-free media. After washing twice with PBS, cells invading through the Matrigel layer were fixed with methanol followed by mounting and staining with Giemsa stain for 15 min. The inner side of the chambers was wiped with a cotton swab. The number of invading cells from at least five fields of each of three separate membranes was counted under an inverted microscope (Olympus Cor., Tokyo, Japan). Three independent experiments were carried out in triplicate.
The MG63 cells were routinely digested and resuspended in DMEM/F12 medium without FBS and seeded at a density of 5×104 cells/well in the upper chamber of Transwell containing 200 L serum-free medium allowed to invade for 24 h toward the lower chamber containing 1×104 cells/mL macrophages and 800 L of conventional DMEM/F12 medium supplemented with 10% FBS. After washing twice with PBS, cells invading through the Matrigel layer were fixed with absolute alcohol for 15 min, dried at RT, followed by mounting and staining with 0.1% crystal violet for 15 min at RT. The inner side of the chambers was wiped with a cotton swab. The number of invading cells from at least five fields of each of three separate membranes was counted under an inverted microscope (Olympus Cor., Tokyo, Japan). Three independent experiments were carried out in triplicate.
Quantitative Real-time PCR (qRT-PCR)
The total RNA was extracted from exosomes or MG63, hFOB cells, and transfected MG63 cells extracted using Trizol Reagent (Invitrogen). The RNA quality and concentration were measured using a spectrophotometer. The reverse transcription reaction was performed to reverse transcribe RNA into cDNA using RevertAidTM First Strand cDNA Synthesis Kit (Thermo Scientific) following the manufacturer’s protocols. qRT-PCR was performed with the SYBR Green Master Mix Kit (Shanghai Solarbio Biological Company) on an ABI Prism 7000 sequence detection system (Applied Biosystems). Expression of target genes was normalized to the expression of GAPDH relative gene expression levels were quantified using the 2-Δ∆Ct method. Three independent experiments were performed in triplicates. The following primers were synthesized (Shanghai Biotech) and used for RT-PCR: Tim–3-F: 5’-ACTCTACTCTACCTACATCTGGGACACT–3’, Tim–3-R: 5’-GTAGGTCCCATGGTCATCCAG–3’; Arg–1-F: 5’-TTGGGTGGATGCTCACACTG–3’, Arg–1-R:5’-TTGCCCATGCAGATTCCC–3’;CD206-F:5’-CAGGTGTGGGCTCAGGTAGT –3’, CD206-R:5’-TGTGGTGAGCTGAAAGGTGA–3; CD163-F:5’-GCCGGCTATCCAGACAATTA–3’, CD163-R:5’-GGCCAAACTGAGGTGGTTTA–3’; iNOS-F:5’- CAGCTGGGCTGTACAAACC TT–3’;iNOS-R:5’-CAGCTGGGCTGTACAAACCTT–3’; IL–10-F:5’-TGCTATGCTGCCTGCTCTTA–3’, IL–10-R:5’-TCATTTCCGATAAGGCTTGG–3’; GAPD-F: 5’-GGAGAAACCTGCCAA GTATG–3’, GAPD-R:5’-TTACTCCTTGGAGGCCATGTAG–3’; TGF-β-F5’- GGGATGAGCTAGTGCTGATCTGG–3’, TGF-β-R:5’-AAACTTGCTCCATGTCCTGCTCTA–3’; VEGF-F:5’-TGCAGGTGATGCTGACAGAGG–3’, VEGF-R:5’- GGATGAGCTAGTGCTGATCTGG–3’
Western blot Assay
Total proteins were extracted from the osteosarcoma and para-carcinoma tissues or exosomes or MG63, hFOB cells or transfected MG63 cells on ice with radio-immunoprecipitation assay (RIPA) cell lysis buffer supplemented with protease inhibitors. Protein concentrations were quantified by the BCA method. Cell lysates were separated using 12% sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and then transferred the proteins onto the polyvinylidene difluoride (PVDF) membrane. The membranes were blocked with 5% skim milk in Tris-buffered saline with Tween–20 for 2 h at RT. Subsequently, the membrane was incubated with primary antibodies including rabbit anti-mouse/human Tim–3 (1: 500), E-cadherin (1: 800), N-cadherin (1: 800), Vimentin (1: 800), and CD9 ( 1: 600), CD81 (1: 600), CD63 (1: 600), GAPDH (1: 1000) in 5% blocking buffer overnight at 4 °C. Then, the membranes were washed twice with TBST solution for 5 min/time, incubated with horseradish enzyme-labeled secondary antibody (1: 5000) for 1 h at RT. The target bands were visualized using the Enhanced Chemiluminescence Kit and the protein bands were quantified using Image J software. Using GAPDH as the internal reference, the ratio of gray value between the target band and internal reference band was considered as the relative expression of the target proteins. Three independent experiments were performed in triplicates.
Pulmonary metastases of osteosarcoma
The animals were cared for in accordance with the Guide for the care and use of laboratory animals in China. All procedures and animal experiments were approved by the Animal Protection and application committee of Huanggang Central Hospital. Fifteen male BALB/c mice (age 4–5 weeks, weight 200 to 250 g) were obtained from the Institute of Zoology, Chinese Academy of Sciences. Mice were housed under specific-pathogen-free (SPF) controlled conditions of (22 ± 1)°C temperature, 60% ± 10 humidity with a 12 h light/dark cycle and ad libitum access to water and sterile food pellets Mice were randomly divided into 3 groups (5 in each group). MG63 and macrophages induced by MG63-Exo or NC-Exo or Tim–3 KO-Exo were administered via tail vein to observe the lung metastasis of osteosarcoma. After 5 weeks, mice in each group were anesthetized and sacrificed. All the suspected lesions of lung metastasis collected and fixed with 10% buffered formalin for (12–24) h at RT, then paraffin-embedded, and sectioned into 4-μm-thick sections. The sections were prepared for histologic examination following staining with hematoxylin and eosin (H&E).
Statistical analysis
Statistical analyses were performed using the SPSS software package (version 19.0; IBM, Chicago, IL, USA). All graphs were produced by GraphPad Prism 5.0 for Windows software (GraphPad Software Inc., La Jolla, CA, USA). Data were expressed as mean ± standard deviation (SD). The comparison between the two groups was performed using the independent sample t-test, and the comparison among multiple groups was performed by one-way analysis of variance (ANOVA) followed by Bonferroni’s correction post hoc test for multiple comparisons. All tests were 2-sided, and P <0.05 was considered statistically significant.