Development Of A Detection System For ESR1 Mutations In Circulating Tumour DNA Using PNA-LNA-Mediated PCR Clamping

doi:10.21203/rs.3.rs-1410750/v1

Background: ESR1 gene mutations are an essential mechanism of resistance to endocrine therapy in patients with oestrogen receptor-positive breast cancer. ESR1 mutations can exist at multiple sites and are typically detected polyclonally after endocrine therapy. The use of circulating tumour DNA (ctDNA) is a less invasive and less expensive method for assessing ESR1 mutations. Adequate amounts of DNA are required to assess polyclonal ESR1 mutations using next-generation sequencing (NGS). The aim of this study was to develop a method to assess polyclonal ESR1 mutations in blood samples.

Methods: We developed a novel detection system to screen for ESR1-activated mutations in ctDNA by combining a peptide nucleic acid and locked nucleic acid polymerase chain reaction (PNA-LNA PCR) clamping assay for detection of the most common mutations: E380Q, Y537S, and D538G. Other mutations in codons 536-538 were detected by direct sequencing of the amplified product following clamp PCR. A validation assay was prospectively performed on clinical samples and compared with the NGS results.

Results: The PNA-LNA PCR clamp assay was validated using six blood samples in which ESR1 mutations were detected by NGS and four samples in which no mutations were detected. Results of the PNA-LNA assay were comparable with those of NGS. We prospectively assessed the concordance between the PNA-LNA PCR clamp method and NGS. Using the PNA-LNA PCR clamp method, ESR1 mutations were detected in 5 of 18 samples, including those in which mutations were not detected by NGS due to the small amount of ctDNA.

Conclusions: The PNA-LNA PCR clamping method is a highly sensitive and minimally invasive assay for the detection of polyclonal ESR1 mutations in the ctDNA of patients with breast cancer.

ESR1 mutations

breast cancer

peptide nucleic acid and locked nucleic acid polymerase chain reaction

next-generation sequencing

circulating tumour DNA

Oestrogen receptor alpha (ERα), encoded by the ESR1 gene, is a member of the nuclear hormone receptor superfamily and is expressed in approximately 70% of breast cancer cases [1]. Patients with metastatic oestrogen receptor (ER)-positive breast cancer are treated with a variety of endocrine therapies until they eventually develop endocrine resistance or visceral crisis [2]. Although ESR1 mutations are rare in primary breast cancers, they are frequently reported in patients with recurrent breast cancer who previously received endocrine therapy [3–5]. Furthermore, ESR1 mutations have emerged as an essential mechanism of resistance to endocrine therapy and as predictive biomarkers for resistance to therapy and potential therapeutic targets.

With the improvement of next-generation sequencing (NGS) technology, genomic analysis of blood samples from cancer patients has been conducted in various studies [6], and the detection of ESR1 mutations in circulating tumour DNA (ctDNA) in patients with breast cancer has been reported [7–11]. In addition, the presence of ESR1 mutations has been reported to impact the efficacy of subsequent treatment modalities [7]. The most frequently occurring ESR1 mutations are in the ligand-binding domain (LBD) of ERα, generally clustering between amino acids 534 and 538. D538G, Y537S, L536Q, Y537N, Y537C, and E380Q are major hotspot mutations in the LBD of ERα, and preclinical research has shown that these mutations confer resistance to hormone therapy [5, 12–15]. Polyclonal detection of these genomic hotspot mutations after endocrine therapy has been reported [16]. Evaluating ESR1 mutations in ctDNA using NGS technology can detect rare mutation sites and polyclonal mutations; however, it requires a sufficient amount of nucleic acid and is time-consuming. In contrast, digital polymerase chain reaction (PCR) can evaluate hotspot mutations with high sensitivity, as shown in several studies [7, 8, 10, 11, 16–18]. However, PCR can only detect mutations at specifically defined sites.

Peptide nucleic acid (PNA)-based PCR is a highly sensitive and specific approach for the detection of genetic mutations. This technique enhances the specificity of the PCR reaction by targeting the initial step involved in nonspecific amplification, namely, primer binding to a mismatched target sequence. PNA is a DNA analogue in which the four nucleotides, adenine (A), thymine (T), guanine (G), and cytosine (C), are attached to an N-(2-aminoethyl) glycine backbone rather than to the negatively charged deoxyribose phosphate backbone present in DNA [19]. Genomic analysis using the PNA-locked nucleic acid (LNA)-mediated PCR clamping (PNA-LNA PCR clamp) method has been shown to be highly sensitive in detecting gene mutations in EGFR and RAS [20–23]. Although the use of ctDNA is a less invasive and less expensive method for assessing ESR1 mutations, few studies have evaluated its feasability compared to NGS. The amplified product of clamp PCR can also be directly sequenced to evaluate mutations in the defined region. This feature was considered useful for assessing polyclonal ESR1 mutations, and we developed a novel assay for the detection of polyclonal ESR1 mutations in ctDNA using the PNA-LNA PCR clamp method. In addition, patient blood samples were prospectively collected to evaluate the feasibility of this system compared to NGS.

Design for the detection of ESR1 mutations

To develop a detection system for ESR1 mutations using PNA-LNA PCR clamping, we focused on three common hotspot mutations in ESR1 (E380Q, Y537S, and D538G) that have been reported to be important for acquired resistance to endocrine therapy [7, 24, 25]. In addition to these three hotspots, other ESR1 mutations have also been detected at lower frequencies, mainly in the region of codons 536–538 [25]. Therefore, we performed direct sequencing of the 536–538 codon region using amplified products obtained by clamp PCR targeting D538G and Y537S to identify additional mutations in this region (Fig. 1).

Plasmids

Wild-type fragments containing the ESR1 gene were amplified using PCR from normal human genomic DNA (gDNA). The primers used are shown in Table 1. The amplified fragments were cloned into the pGEM® T Easy vector (Promega, WI, USA), and the plasmid DNA was extracted. Plasmids with ESR1 mutations were produced by transfection of wild-type plasmid DNA into the template using the PrimeSTAR Mutagenesis Basal Kit (Takara Bio, Japan).

Table 1

Primer Sequences
Primer	Oligo sequence, 5’ to > 3’
Evaluation to number of ESR1 gene copies ESR1-S-F ESR1-S-R ESR1-S-Total	5’-CAGTAACAAAGGCATGGAGCA-3’ 5’-CTAGTGGGCGCATGTAGGC-3’ 5’-Cy5/ACGTTCTTGCACTTCATGCTG/BHQ-3’
Reaction_E380Q ESR1 E380Q-AS-F ESR1 E380Q-AS-R ESR1 E380Q-AS-Total ESR1 E380Q-AS-LNA ESR1 E380Q-AS-PNA	5’-AGTAGCTTCCCTGGGTGCTC-3’ 5’-TGACCCTCCATGATCAGGTCC-3’ 5’-Cy5/CTGATGATTGGTCTCGTCTGGC/BHQ-3’ 5’-FAM/AGGCACAT + T + G + TAGAAG/BHQ-3’ 5’-GGCACATTCTAGAAGG-3’
Reaction_Y357S and D538G ESR1-S-F ESR1-S-R ESR1-S-Total ESR1 Y357S-S-LNA ESR1 D538G-S-LNA ESR1 S-PNA	5’-CAGTAACAAAGGCATGGAGCA-3’ 5’-CTAGTGGGCGCATGTAGGC-3’ 5’-Cy5/ACGTTCTTGCACTTCATGCTG/BHQ-3’ 5’-FAM/CCCCTC + T + C + TGACCT/BHQ-3’ 5’-HEX/CTCTAT + GG + CCTG + CTG/BHQ-3’ 5’-GCCCCTCTATGACCTGC-3’

PNA-LNA PCR clamp assay

The number of ESR1 copies per 2 µL of ctDNA of each sample was calculated based on a standard by real-time PCR. A standard was prepared with 1.0 × 10² to 1.0 × 10⁵ copies from wild-type gDNA. The primers used are shown in Supplemental Table 1. Real-time PCR was performed using the LightCycler® 480 System II (Roche Life Science, Germany). The thermal cycling profile was 95°C for 5 min, followed by 50 cycles of 95°C for 5 s and 62°C for 30 s. Genomic DNA was purified using a QIAamp DNA Blood Kit (Qiagen, Germany).

ESR1 mutations E380Q, Y537S, and D538G were analysed. PNA-LNA clamp PCR was performed using 4 µL of ctDNA from each patient sample as template DNA. Mutational analyses of Y537S and D538G were performed simultaneously. PNA-LNA clamp PCR was performed using the LightCycler® 480 System II (Roche Life Science, Germany). PCR cycling commenced at 95°C for 5 min, followed by 50 cycles of 95°C for 5 s and 62°C for 30 s.

PNA-LNA clamp PCR products obtained during the mutational analysis of Y537S and D538G were used as template DNAs for amplifying the regions containing codons 536, 537, and 538 using nested PCR. These PCR products were used as template DNA and then sequenced by direct sequencing. The sequencing reagent used was the BigDye Terminator V3.1 Cycle Sequencing kit (Applied Biosystems/Thermo Fisher Scientific, MA, USA). Sequencing reaction samples were purified using the BigDye X Terminator Purification Kit (Applied Biosystems/Thermo Fisher Scientific, MA, USA) and then analysed using the PRISM 3730XL (Applied Biosystems/Thermo Fisher Scientific, MA, USA) to detect mutations in codons 536, 537, and 538 of the ESR1 gene.

The efficiency of PCR clamping was determined by measuring the crossing point (Cp) value. The delta Cp (ΔCp) value was calculated as follows: "Cp of sample with PNA" − "Cp of sample without PNA". "Cp of sample without PNA" was calculated as a conversion from the ESR1 copy number.

Clinical samples

To evaluate methods for the detection of ESR1 gene mutations in blood samples, a prospective study was conducted in patients with recurrent metastatic hormone receptor-positive breast cancer at the National Cancer Center Hospital, Japan, from June 2019 to January 2021. The study included two cohorts: (1) the developmental cohort and (2) the prospective validation cohort (Fig. 2). Patient characteristics are shown in Supplemental Table 1. Patients who consented to the study had 12 mL of blood collected when they were diagnosed with progressive disease (PD) following endocrine therapy or chemotherapy. Ethylene-diaminetetraacetic acid (EDTA)-2K tubes were used as blood collection tubes. Institutional review board and ethics committee approval was obtained from our institutions. This study was conducted in accordance with the Declaration of Helsinki [26], and the study protocol was approved by the Institutional Review Board of the National Cancer Center Hospital, Tokyo, Japan (approval number: 2016-024). All participants provided written informed consent prior to the study-related procedures. This study followed the Strengthening the Reporting of Observational Studies in Epidemiology (STROBE) reporting guidelines (http://www.strobe-statement.org/). No statistical methods were used to determine the sample size. Mutations obtained from clinical samples were blinded from the investigators to avoid bias.

Clinical sample collection and cell-free DNA/TNA extraction

Plasma samples were collected in EDTA tubes and stored at − 80°C. For the developmental cohort, cell-free DNA (cfDNA) was obtained from collected peripheral blood using the MagMAX™ Cell-Free DNA Isolation kit (Thermo Fisher Scientific, MA, USA) according to the manufacturer's instructions. For the prospective validation cohort, cell-free total nucleic acid (cfTNA) was extracted from blood using the MagMAX™ Cell-Free Total Nucleic Acid Isolation Kit (Thermo Fisher Scientific, MA, USA). The amounts of cfDNA and cfTNA were quantified using the Qubit dsDNA HS Assay Kit (Thermo Fisher Scientific, MA, USA).

Targeted NGS

cfDNA and cfTNA from the patient samples in the developmental and prospective validation cohorts were assessed using the following methods.

Developmental cohort: ESR1 mutations in cfDNA were assessed using the Oncomine Pan-Cancer Cell-Free Assay (Ion Torrent™, Thermo Fisher Scientific, MA, USA) following the manufacturer’s protocol. Templating and sequencing were performed using an Ion 540™ Kit-Chef (Thermo Fisher Scientific, Waltham, MA, US). Variant calling of sequencing data was performed using Torrent Suite Software 5.10 and Ion Reporter 5.6 software. This assay was designed to target seven hotspot single nucleotide variants of ESR1 (E380Q, V392I, S463P, Y537S, Y537N, Y537C, and D538G). L536H [27] and L536R [18, 28] mutations were added to the analysis because these may be genomic abnormalities involved in resistance to hormone therapy, although present at a low frequency.

Analysis of the cohorts was conducted using the Oncomine™ Precision Assay (Thermo Fisher Scientific, MA, USA), a platform that produces rapid results, as well as PCR. Templating and sequencing were performed using Genexus™ Templating Strips 3 and 4-GX5™ and Genexus™ Pipette Tips (Thermo Fisher Scientific, MA, USA). Templated samples were sequenced using the Genexus™ Sequencing Kit (Thermo Fisher Scientific, MA, USA). Variant calling from the sequence data was performed using Genexus Software 6.2 and Ion Reporter 5.14 software.

PNA-LNA PCR clamp reaction for the detection of ESR1 mutations

We checked the amplification of the target product using electrophoresis to evaluate the performance of the designed primers. Specific amplification of the target product was confirmed (Fig. 3A). We performed PNA clamp assays to confirm that the mutant allele was not amplified and that the wild-type allele was amplified (Fig. 3B). The specificity of the LNA probes for mutation detection was evaluated. Without the addition of PNA, the wild-type gDNA showed a slight signal for D538G, which was suppressed by the addition of PNA (Fig. 3C). Finally, the sensitivity of the probes for the detection of ESR1 gene mutations was evaluated using standard samples (Fig. 3D). The probes for all ESR1 gene mutations showed a detection sensitivity of 0.1%. Standard samples of ESR1 gene mutations in Y537S and L536R were evaluated by direct sequencing, and mutations were detected with a sensitivity of 0.1%.

Developmental cohort

We then validated the assay using clinical samples. cfDNA was extracted from blood samples of patients with hormone receptor-positive breast cancer, and ESR1 mutations were identified by NGS, using the Oncomine pan-cancer cell-free assay. ESR1 mutations were detected in 6 of 22 patients. The sites and allele frequencies of the mutations detected in each patient sample are shown in Supplemental Table 2. Of the six patients with ESR1 mutations, five had polyclonal mutations. The concordance of detection of ESR1 mutations between the PNA-LNA PCR clamp method and NGS was evaluated for these six samples with ESR1 mutations and four samples without ESR1 mutations. The median Cp value of the samples in which ESR1 gene mutations were detected was 28.02, compared with the Cp value of 29.70 for samples in which ESR1 gene mutations were not detected, showing no significant difference (Mann–Whitney U test).

Detection of E380Q, Y537S, and D538G mutations using the PNA-LNA PCR clamp assay was positive in all samples confirmed by NGS (Tables 2–4). We further evaluated whether these mutations were detectable by direct sequencing and found that they were indeed present in all samples (Supplemental Fig. 1A). The PNA-LNA PCR clamp assay detected a D538G mutation in one of the four samples that did not show any genetic mutations by NGS (Table 4). This specimen was evaluated by direct sequencing and was found to contain a D538G mutation (Supplemental Fig. 1B). Additionally, L536H, Y537N, and Y537C were detected by NGS as hotspot mutations in addition to E380Q, Y537S, and D538G (Supplemental Table 1). Specimens with L536H mutations also showed Y537S and D538G mutations, and direct sequencing detected Y537S and D538G, but not L536H mutations (Sample #4, Supplemental Fig. 1A). In the two specimens in which Y537N mutations were identified by NGS, one was detected by the PNA-LNA PCR clamp reaction assay, while the other was not (Samples #1 and #3, Supplemental Fig. 1C). The Y537N mutation was not detected in either sample by direct sequencing. Samples with the Y537C mutation were confirmed to have the mutation by direct sequencing (Sample #6, Supplemental Fig. 1D).

Table 2

Evaluation of E380Q detection using PNA-LNA PCR Clamp reaction
Sample	Cp value	Cp value			E380Q
Sample	Cp value	PNA+	PNA-	⊿Cp	E380Q
#1	N.D.	35.12	26.44	8.68	WT
#2	34.57	33.66	28.46	5.20	Detection
#3	N.D.	33.97	24.37	9.60	WT
#4	N.D.	40.73	29.98	10.75	WT
#5	34.91	33.83	26.93	6.90	Detection
#6	N.D.	39.88	29.78	10.10	WT
Neg_#1	N.D.	37.18	28.44	8.74	WT
Neg_#2	N.D.	39.18	30.24	8.94	WT
Neg_#3	N.D.	39.16	29.98	9.18	WT
Neg_#4	N.D.	36.49	27.67	8.82	WT
WT: wild-type, N.D, not detected, Cp: crossing point

Table 3

Evaluation of Y537S detection using PNA-LNA PCR Clamp reaction
Sample	Cp value	Cp value			Y537S
Sample	Cp value	PNA+	PNA-	⊿Cp	Y537S
#1	31.92	31.91	25.83	6.08	Detection
#2	N.D.	31.33	27.85	3.48	WT
#3	29.47	29.01	23.76	5.25	Detection
#4	36.66	36.34	29.37	6.97	Detection
#5	N.D.	30.66	26.32	4.34	WT
#6	N.D.	38.28	29.17	9.11	WT
Neg_#1	N.D.	37.71	27.83	9.88	WT
Neg_#2	N.D.	41.64	29.63	12.01	WT
Neg_#3	N.D.	41.93	29.37	12.56	WT
Neg_#4	N.D.	38.32	27.06	11.26	WT
WT: wild-type, N.D, not detected, Cp: crossing point

Table 4

Evaluation of D538G detection using PNA-LNA PCR Clamp reaction
Sample	Cp value	Cp value			D538G
Sample	Cp value	PNA+	PNA-	⊿Cp	D538G
#1	32.87	31.91	25.83	6.08	Detection
#2	31.56	31.33	27.85	3.48	Detection
#3	29.84	29.01	23.76	5.25	Detection
#4	36.68	36.34	29.37	6.97	Detection
#5	30.85	30.66	26.32	4.34	Detection
#6	N.D.	38.28	29.17	9.11	WT
Neg_#1	37.92	37.71	27.83	9.88	Detection
Neg_#2	N.D.	41.64	29.63	12.01	WT
Neg_#3	43.26	41.93	29.37	12.56	WT
Neg_#4	39.19	38.32	27.06	11.26	WT
WT: wild-type, N.D, not detected, Cp: crossing point

Overall, we found that the sensitivity and accuracy of the detection of ESR1 mutations using the PNA-LNA PCR clamping assay were comparable with those of NGS.

Prospective validation cohort

Next, we evaluated whether PNA-LNA PCR clamping could identify ESR1 mutations as accurately as NGS in patient samples. Eighteen patients with recurrent metastatic hormone receptor-positive breast cancer who developed PD following previous treatment were enrolled, and their blood samples were analysed. Detection of ESR1 mutations and hotspot regions using PNA-LNA PCR clamping and NGS is shown in Table 5. PNA-LNA PCR clamping detected ESR1 mutations in 5 of 18 samples. The recommended amount of cfTNA for the analysis using the Oncomine™ Precision Assay was 1.33 ng/µL (20 µL), and 6 of 18 samples met that criterion (Supplemental Table 3). The two samples (#11 and #15) in which ESR1 mutations were detected by PNA-LNA PCR clamping and not by NGS had very low quantities of cfDNA (less than 0.5 ng/µL) (Supplemental Table 4). These results indicate that our method is highly sensitive for detecting ESR1 mutations in samples where cfDNA levels are too low to be analysed by NGS.

Table 5

Detection of *ESR1* mutations using PNA-LNA PCR clamping compared with NGS
Sample	PNA-LNA PCR clamp	NGS
#1	E380Q and D538G	E380Q, L536Q and D538G
#2	WT	WT
#3	WT	WT
#4	WT	WT
#5	WT	WT
#6	WT	WT
#7	E380Q and L536H	E380Q and L536H
#8	WT	WT
#9	WT	WT
#10	WT	NE
#11	Y537S	WT
#12	WT	NE
#13	WT	NE
#14	WT	WT
#15	D538G	WT
#16	WT	WT
#17	Y537S	Y537S
#18	WT	WT
NGS: next generation sequencing, WT: wild-type, NE: Not Evaluated

Here, we report a novel method for the detection of ESR1 mutations in ctDNA using PNA-LNA PCR clamping. Although the PNA-LNA PCR clamp method is highly sensitive, a large number of samples and multiple PCR reactions would be needed to detect a wide range of gene mutations. Because a simple, low-cost, and minimally invasive blood test is desirable for use in clinical practice, we designed an assay method specifically for the detection of high-frequency mutations and mutations associated with therapeutic resistance. The common mutations D538G, Y537S, and E380Q were detected using LNA probes, and additional mutations in codons 536–538 were detected by direct sequencing of the amplified clamp PCR product (Fig. 1).

ER-positive breast cancer accounts for approximately 70% of all breast cancers, and endocrine therapies are effective in these patients. Various mechanisms of resistance to endocrine therapies have been reported, including ESR1 missense mutations [3–5]. More than 50 ESR1 missense mutations have been identified [29]. Although the clinical significance of all hotspot mutations is unknown, ESR1 mutations in the LBD region are associated with resistance to tamoxifen and fulvestrant [5, 13, 15, 30]. The most common ESR1 mutations are the E380Q, Y537S, and D538G, and these hotspots account for 70% of the ESR1 mutations [31]. Recently, many studies have reported the detection of ESR1 mutations using NGS and digital PCR [7–11, 16–18]. Although NGS is expensive and requires high concentrations of cfDNA, it is commonly used to detect polyclonal ESR1 mutations. We found that our method detected polyclonal ESR1 mutations with a sensitivity similar to that of NGS and could be performed using only 3 mL of plasma, thus providing a minimally invasive and cost-effective monitoring method.

The PNA-LNA PCR clamp method uses a PNA complementary to the wild-type sequence and a fluorophore-labelled LNA complementary to the mutant sequence to evaluate mutations in the target gene. Because PNA probes form a high-strength double-stranded bond with DNA, a single-base mismatch causes a significant decrease in the melting temperature (Tm). In addition, a PNA is less susceptible to displacement by DNA polymerase. Thus, the addition of a PNA sequence complementary to the wild-type sequence inhibits the amplification of the wild-type sequence in the reaction mix. LNA, like PNA, also forms a high-strength double-stranded bond with DNA, and the Tm is greatly reduced by a single-base mismatch. Therefore, the use of a fluorophore-labeled LNA, which is complementary to the mutant sequence, enables the highly sensitive and specific detection of small amounts of mutant sequences in a background of wild-type sequences. Unlike digital PCR, the PNA-LNA clamp method is qualitative rather than quantitative. Although quantitative evaluation of some mutations, such as PIK3CA, has been reported to be significant in predicting treatment response [32], the significance of quantitative evaluation of ESR1 mutations has not been clarified. However, ESR1 mutation is a biomarker that predicts a weaker response to endocrine therapy, and its qualitative detection is considered to be significant.

While our results are promising, it is not entirely clear whether these results can be applied for the detection of all polyclonal ESR1 mutations in ctDNA. The number of patient samples used in this study was small, and validation of the polyclonal hotspot mutations was limited. In order to evaluate the detection sensitivity for several polyclonal hotspot mutations, it is necessary to validate the system with a larger number of patient specimens. Furthermore, our method cannot detect all potential ESR1 mutations across all regions of the gene as effectively as NGS does.

In conclusion, our PNA-LNA-mediated PCR clamping assay is a highly sensitive and minimally invasive assay that could be a useful monitoring tool for the detection of ESR1 mutations in the cfDNA of patients with breast cancer.

cfDNA: Cell-free DNA

cfTNA: Cell-free total nucleic acid

ctDNA: circulating tumour DNA

Cp: Crossing point

EDTA: Ethylene-diaminetetraacetic acid

ER: Oestrogen receptor

gDNA: Genomic DNA

LBD: Ligand-binding domain

LNA: Locked nucleic acid

NGS: Next-generation sequencing

PCR: Polymerase chain reaction

PD: Progressive disease

PNA: Peptide nucleic acid

Ethics approval and consent to participate

Institutional review board and ethics committee approval was obtained from our institutions. This study was conducted in accordance with the Declaration of Helsinki. The study protocol was approved by the Institutional Review Board of the National Cancer Center Hospital, Tokyo, Japan (approval numbers: 2016-024). All participants provided written informed consent prior to the study-related procedures. This study followed the Strengthening the Reporting of Observational Studies in Epidemiology (STROBE) reporting guidelines (http://www.strobe-statement.org/).

Consent for publication

All participants provided written informed consent prior to the study-related procedures.

Availability of data and materials

The datasets used in the present study are available from the corresponding author upon reasonable request.

Competing Interests

Yuki Kojima, Tomomi Yoshino, Shigehiro Yagishita, Shu Yazaki, Hitomi S. Okuma, Kazuki Sudo, Maki Tanioka, Tatsunori Shimoi, Kenji Tamura have nothing to disclose; Tadaaki Nishikawa received research funds from Takeda Pharmaceutical Company, Eisai, AstraZeneca, outside the submitted work; Emi Noguchi received research funds from Pfizer, Taiho, Eli Lilly, AstraZeneca, Chugai, Eisai, outside the submitted work; Ayaka Kazamaand Hiroshi Terasaki are employees of LSI Medience Corporation; Sachiro Asano is employees of Life Technologies Japan Ltd., Thermo Fisher Scientific; Akinobu Hamada received research funds from Shimadzu Corporation, Daiichi Sankyo Company, Chugai Pharmaceutical, AstraZeneca, outside the submitted work; Yasuhiro Fujiwara received research funds from AstraZeneca, Chugai, Daiichi Sankyo, Bristol-Myers, SRL, Santen, outside the submitted work; Kan Yonemori received research funds from Pfizer, AstraZeneca, Eisai, Takeda Pharmaceutical Company, Chugai, Ono Pharmaceutical Company, Novartis, Daiichi Sankyo, outside the submitted work.

Funding

This study was partly supported by LSI Medience Corporation and Thermo Fisher Scientific.

Authors' contributions

Y.K and K.Y had full access to all the data and take responsibility for their integrity the accuracy of their analysis.

Concept and design: Y.K., K.Y.

Acquisition, analysis, or interpretation of data: All authors.

Drafting of the manuscript: Y.K., K.Y.

Administrative, technical, or material support: A.K., H.T., S.A.

Supervision: K.Y.

Acknowledgments

We thank all participants for their participation in this study. We thank Nao Nakamura and Kyoko Onozawa for their secretarial assistance. The National Cancer Center Biobank is supported by the National Cancer Center Research and Development Fund, Japan. Editage and Cactus Communications provided editorial support in the form of medical writing, assembling tables, and creating high-resolution images based on authors' detailed directions, collating author comments, copyediting, fact-checking, and referencing.

Clark GM, Osborne CK, McGuire WL. Correlations between estrogen receptor, progesterone receptor, and patient characteristics in human breast cancer. J Clin Oncol. 1984;2:1102–9.
Rugo HS, Rumble RB, Macrae E, Barton DL, Connolly HK, Dickler MN, et al. Endocrine therapy for hormone receptor-positive metastatic breast cancer: American Society of Clinical Oncology Guideline. J Clin Oncol. 2016;34:3069–103.
Najim O, Seghers S, Sergoynne L, Van Gaver H, Papadimitriou K, Wouters K, et al. The association between type of endocrine therapy and development of estrogen receptor-1 mutation(s) in patients with hormone-sensitive advanced breast cancer: A systematic review and meta-analysis of randomized and non-randomized trials. Biochim Biophys Acta Rev Cancer. 2019;1872:188315.
Jeselsohn R, Yelensky R, Buchwalter G, Frampton G, Meric-Bernstam F, Gonzalez-Angulo AM, et al. Emergence of constitutively active estrogen receptor- α mutations in pretreated advanced estrogen receptor-positive breast cancer. Clin Cancer Res. 2014;20:1757–67.
Toy W, Shen Y, Won H, Green B, Sakr RA, Will M, et al. ESR1 ligand-binding domain mutations in hormone-resistant breast cancer. Nat Genet. 2013;45:1439–45.
Haber DA, Velculescu VE. Blood-based analyses of cancer: Circulating tumor cells and circulating tumor DNA. Cancer Discov. 2014;4:650–61.
Fribbens C, O'Leary B, Kilburn L, Hrebien S, Garcia-Murillas I, Beaney, et al. Plasma ESR1 mutations and the treatment of estrogen receptor-positive advanced breast cancer. J Clin Oncol. 2016;34:2961–8.
Schiavon G, Hrebien S, Garcia-Murillas I, Cutts RJ, Pearson A, Tarazona N, et al. Analysis of ESR1 mutation in circulating tumor DNA demonstrates evolution during therapy for metastatic breast cancer. Sci Transl Med. 2015;7:313ra182.
Guttery DS, Page K, Hills A, Woodley L, Marchese SD, Rghebi B, et al. Noninvasive detection of activating estrogen receptor 1 (ESR1) mutations in estrogen receptor-positive metastatic breast cancer. Clin Chem. 2015;61:974–82.
Chu D, Paoletti C, Gersch C, VanDenBerg DA, Zabransky DJ, Cochran RL, et al. ESR1 mutations in circulating plasma tumor dna from metastatic breast cancer patients. Clin Cancer Res. 2016;22:993–9.
Wang P, Bahreini A, Gyanchandani R, Lucas PC, Hartmaier RJ, Watters RJ, et al. Sensitive detection of mono- and polyclonal ESR1 mutations in primary tumors, metastatic lesions, and cell-free DNA of breast cancer patients. Clin Cancer Res. 2016;22:1130–7.
Weis KE, Ekena K, Thomas JA, Lazennec G, Katzenellenbogen BS. Constitutively active human estrogen receptors containing amino acid substitutions for tyrosine 537 in the receptor protein. Mol Endocrinol. 1996;10:1388–98.
Zhang QX, Borg A, Wolf DM, Oesterreich S, Fuqua SA. An estrogen receptor mutant with strong hormone-independent activity from a metastatic breast cancer. Cancer Res. 1997;57:1244–9.
Merenbakh-Lamin K, Ben-Baruch N, Yeheskel A, Dvir A, Soussan-Gutman L, Jeselsohn R, et al. D538G mutation in estrogen receptor-α: A novel mechanism for acquired endocrine resistance in breast cancer. Cancer Res. 2013;73:6856–64.
Robinson DR, Wu YM, Vats P, Su F, Lonigro RJ, Cao X, et al. Activating ESR1 mutations in hormone-resistant metastatic breast cancer. Nat Genet. 2013;45:1446–51.
Takeshita T, Yamamoto Y, Yamamoto-Ibusuki M, Inao T, Sueta A, Fujiwara S, et al. Droplet digital polymerase chain reaction assay for screening of ESR1 mutations in 325 breast cancer specimens. Transl Res. 2015;166:540 – 53.e2.
Chandarlapaty S, Chen D, He W, Sung P, Samoila A, You D, et al. Prevalence of ESR1 mutations in cell-free DNA and outcomes in metastatic breast cancer: A secondary analysis of the BOLERO-2 clinical trial. JAMA Oncol. 2016;2:1310–15.
Jeannot E, Darrigues L, Michel M, Stern MH, Pierga JY, Rampanou A, et al. A single droplet digital PCR for ESR1 activating mutations detection in plasma. Oncogene. 2020;39:2987–95.
Giesen U, Kleider W, Berding C, Geiger A, Orum H, Nielsen PE. A formula for thermal stability (Tm) prediction of PNA/DNA duplexes. Nucleic Acids Res. 1998;26:5004–6.
Miyazawa H, Tanaka T, Nagai Y, Matsuoka M, Huqun, Sutani A, et al. Peptide nucleic acid-locked nucleic acid polymerase chain reaction clamp-based detection test for gefitinib-refractory T790M epidermal growth factor receptor mutation. Cancer Sci. 2008;99:595–600.
Nagai Y, Miyazawa H, Huqun, Tanaka T, Udagawa K, Kato M, et al. Genetic heterogeneity of the epidermal growth factor receptor in non-small cell lung cancer cell lines revealed by a rapid and sensitive detection system, the peptide nucleic acid-locked nucleic acid PCR clamp. Cancer Res. 2005;65:7276–82.
Kim HR, Lee SY, Hyun DS, Lee MK, Lee HK, Choi CM, et al. Detection of EGFR mutations in circulating free DNA by PNA-mediated PCR clamping. J Exp Clin Cancer Res. 2013;32:50.
Itonaga M, Matsuzaki I, Warigaya K, Tamura T, Shimizu Y, Fujimoto M, et al. Novel methodology for rapid detection of KRAS mutation using PNA-LNA mediated loop-mediated isothermal amplification. PLoS One 2016;11:e0151654.
Spoerke JM, Gendreau S, Walter K, Qiu J, Wilson TR, Savage H, et al. Heterogeneity and clinical significance of ESR1 mutations in ER-positive metastatic breast cancer patients receiving fulvestrant. Nat Commun. 2016;7:11579.
Shaw JA, Guttery DS, Hills A, Fernandez-Garcia D, Page K, Rosales BM, et al. Mutation analysis of cell-free DNA and single circulating tumor cells in metastatic breast cancer patients with high circulating tumor cell counts. Clin Cancer Res. 2017;23:88–96.
World Medical Association. World Medical Association Declaration of Helsinki: Ethical principles for medical research involving human subjects. JAMA. 2013;310:2191–4.
Yanagawa T, Kagara N, Miyake T, Tanei T, Naoi Y, Shimoda M, et al. Detection of ESR1 mutations in plasma and tumors from metastatic breast cancer patients using next-generation sequencing. Breast Cancer Res Treat. 2017;163:231–40.
Zundelevich A, Dadiani M, Kahana-Edwin S, Itay A, Sella T, Gadot M, et al. ESR1 mutations are frequent in newly diagnosed metastatic and loco-regional recurrence of endocrine-treated breast cancer and carry worse prognosis. Breast Cancer Res. 2020;22:16.
Dustin D, Gu G, Fuqua SAW. ESR1 mutations in breast cancer. Cancer. 2019;125:3714–28.
Gelsomino L, Gu G, Rechoum Y, Beyer AR, Pejerrey SM, Tsimelzon A, et al. ESR1 mutations affect anti-proliferative responses to tamoxifen through enhanced cross-talk with IGF signaling. Breast Cancer Res Treat. 2016;157:253–65.
Toy W, Weir H, Razavi P, Lawson M, Goeppert AU, Mazzola AM, et al. Activating ESR1 mutations differentially affect the efficacy of ER antagonists. Cancer Discov. 2017;7:277–87.
O'Leary B, Hrebien S, Morden JP, Beaney M, Fribbens C, Huang X, et al. Early circulating tumor DNA dynamics and clonal selection with palbociclib and fulvestrant for breast cancer. Nat Commun. 2018;9:896.

No competing interests reported.

SupplementalFigure1.pptx
Supplemental Figure 1. Identification of ESR1 mutations in clinical samples using PNA-LNA PCR clamp assay(A), (B), and (D) Analysis of ESR1 mutations in clinical samples using direct sequencing. (C) Analytical evaluation by PNA-LNA PCR clamp assay for two samples in which the Y537N mutation was detected by NGS (blue line). Red line: analysis of 1.0% and 0.1% of standard samples with Y537N mutations; green line: wild-type ESR1; black line: distilled water. LNA, locked nucleic acid; NGS, next-generation sequencing; PCR, polymerase chain reaction; PNA, peptide nucleic acid.
SupplementalTable14.docx

Development Of A Detection System For ESR1 Mutations In Circulating Tumour DNA Using PNA-LNA-Mediated PCR Clamping

Status:

Version 1

Abstract

Figures

Background

Methods

Design for the detection of ESR1 mutations

Plasmids

PNA-LNA PCR clamp assay

Clinical samples

Clinical sample collection and cell-free DNA/TNA extraction

Targeted NGS

Results

PNA-LNA PCR clamp reaction for the detection of ESR1 mutations

Developmental cohort

Prospective validation cohort

Discussion

Conclusions

Abbreviations

Declarations

References

Additional Declarations

Supplementary Files

Status:

Version 1