Collection of plant
Green tea (Camellia sinensis) was collected from the Botanical Garden and identified under the voucher number 1218-21-03 by the head of Botany Department of University of Agriculture, Faisalabad, Pakistan and plant name was checked with http://www.theplantlist.org.
Preparation of GTPE
Distilled boiled water was added to crudely crush dried green tea leaves in the ratio 10:1 (with periodically stirring to deactivate enzymes). Whatman filter paper was used to collect the filtrate (repeated three times). At 42⁰C, concentrate the green tea solution by hot air oven. Equal volume of dichloromethane used to decaffeinate the filtrate. Ethyl acetate and minute amount of ascorbic acid were added to prevent oxidation. Separating funnel was used to separate polyphenols (Bharadwaz and Bhattacgarjee 2012).GTPE was freeze dried and stored for further analysis.
Estimation of catechins by UV-Vis spectroscopy
10 g of powdered leaves of green tea was added to of distilled water (100 ml) at 100⁰C temperature and stirred with magnetic stirrer for 1h and then filtered. Equal volume of chloroform was used to wash the tea infusion in a separator funnel to remove pigments, caffeine and other non-polar impurities. This washing was repeated five times, the absorbance of the aqueous phase obtained was taken at maximum wavelength (230 nm). The absorption spectra of pure catechins and catechins in green tea were measured using Multiskan Sky with touchscreen and μDrop Plate with wavelength range 200-1000 nm by using UV-visible spectrometer. 1 ml from the stock solution was added into a 10 ml volumetric flask and made up to the mark with distilled water to produce 10 µg/ml solution (Fig 3.6). This was then scanned in the spectrophotometer through range wavelengths (240 – 400 nm) to obtain the wavelength of maximum absorption (Ibrahim et al. 2017).
Characterization of green tea by HPLC
Green tea extract was prepared with slight modifications according to the method of (He et al. 2015) and stored at 4°C in darkness. C (99% purity), EC (99.5% purity), ECG (97% purity), EGC (95% purity), EGCG (99% purity), GC (95.5% purity), and caffeine (97% purity), these reference compounds were purchased from Sigma Chemical Co. For the detection of bioactive compounds, UV–visible detector was used at the wave-length of 210 nm (Wangkarn et al. 2021). A HPLC system equipped with LC-10AT pump, ultraviolet detector model SPD-10AV (Shimadzu Europa GmbH, Duisburg, Japan) and Shim-Pack CLC-ODS (C-18), 25 cm × 4.6 mm, 5 µm column were used for characterization.
Experimental animals
The recent study was carried out on thirty-two (32) female wistar albino rats, weighing 140–200 g. They were acclimatized for period of two weeks before the initiation of experiment. Normal basal diet and tap water ad libitum were given under controlled condition (23 ± 2 °C) and 12:12 h light-dark cycle. The experiment was conducted with preliminary approval by the Directorate of Research and Advance Studies and with consent of Bioethics Committee, University of Agriculture, Faisalabad under issued ethical certificate wide letter no. 1720/ORIC.
Induction of liver fibrosis and experimental layout
The animals were randomly divided into four groups (n=8) after adaptation period. Group 1: Normal .Control. (Normal diet only); Group 2: Positive .Control (High-fat diet+ CCl4); Group 3: Standard (High-fat diet + CCl4 + Silymarin 200 mg/kg); Group 4: GTPE (High-fat diet + CCl4 + Green tea polyphenols 600 mg/kg). The CCl4/olive oil (3 ml per 1000g body weight) induced liver injury via intraperitoneal (i.p.) injection once after 5 days, only 2 doses of CCl4 were countable to induce toxicity. Treatment was started along 2nd dose of CCl4 and given on daily basis. At the end of experiment the rats were decapitated by anesthetic overdose and samples of blood and liver were collected. Biopsy samples were preserved in 10% formalin solution for histopathological studies (Huang et al. 2012).
Measurement of biochemical factors
Blood samples were centrifuged for 10 min at 4000 rpm and resultant serum was stored at -80 ̊C for biochemical investigations. Hemoglobin, total count of red blood corpuscles, total count of white blood cells and platelets were analyzed with hematology auto analyzer MICROS-60 France, as per manufacturer’s .instructions. Serum samples were analyzed for liver function tests and lipid profile (in order to assess any abnormality in functioning of liver) by following method of Parasuraman et al. (2010).
Determination of antioxidant enzymes
Liver tissue was homogenized by using ice-cold PBS, pH 7.1. Fluctuations were monitored in anti-oxidant enzymes (catalase, superoxide dismutase and glutathione peroxidase) by following method of (Popov et al. 2003). Malondialdehyde (MDA) was determined through thiobarbituric acid assay by using colorimetric technique, following Bio-diagnostic kits guidelines (Cusabio Biotech Co., Ltd.).
Estimation of liver inflammatory cytokines
The serum levels of TNF-α and IL-6 (cat. no. CSB-E04639m) were determined by using ZELLBIO GmbH ELISA kit (Germany) according to the manufacturer’s instructions. The cytokine assays were performed in duplicate.
Histopathological examination
Animals were decapitated on 28th day of research trial. Liver tissue samples were collected and added in 10% buffering solution of formalin and store for overnight at 4°C for histopathological analysis by following the method of Huang et al. 2012.
Quantitative real-time PCR assay
Quantitative real-time PCR analysis was performed by using Maxima SYBR Green and Thermo Fisher kit (Majeed et al. 2021). Expressions of NFR-2 and TIMP-1 were studied. Beta actin was acted as a housekeeping gene and internal control. Therefore, genes were amplified by using oligonucleotides (Primers) sequence that mentioned as following:
NRF-2F TCCCGAATGGAACCGAGACT
NRF-2R TTCATCCACGGGAAAGGGAG
TIMP-1F ACAGCTTTCTGCAACTCG
TIMP-1R CTATAGGTCTTTACGAAGGCC
All reactions were carried in triplicates. Following formula was used to analyze relative gene expression
Statistical analysis
Analysis of results was tabulated as mean ± SEM along statistically applied one-way analysis of variance (ANOVA) by using graph pad prism. Tukey’s multiple comparisons test was followed in case of significant differences among control, positive, standard and treated I groups (P ≤ 0.001).