Animals
Animal studies are reported in compliance with the ARRIVE guidelines. All experimental procedures used in this study were approved by Moscow State University committee on animal welfare (94-g) and conformed to the Guide for the Care and Use of Laboratory Animals published by the US National Institutes of Health (Eight edition, 2011)
Adult female (230–280 g) and male (300–350 g) Wistar rats were obtained from the vivarium of the Institute of General Pathology and Pathophysiology (Moscow, Russia) and then bred in the laboratory animal unit of the Biological Faculty of Moscow State University. The animals were maintained on 12/12-h light/dark cycle and fed with normal rodent chow (containing 20% protein, 5% fat, calorie content 300 kcal/100 g) ad libitum.
The model of intrauterine growth restriction
A model of IUGR was used where rat dams were 50% food restricted during the second half of gestation. Sexually mature males and females (age 2.5-3 months) were housed together for a night, at the next morning, the onset of pregnancy was determined by the presence of sperm in a vaginal smear (considered as the GD1). After that, the females were randomly assigned to the control (n = 6) and IUGR (n = 10) groups and placed in cages for individual maintenance. Food and water consumption, as well as body weight were regularly monitored. Dams of both the IUGR and control groups had unlimited access to water throughout gestation and postpartum periods.
From GD1 to GD10, females of both groups had unlimited access to chow. Starting from GD11, the females of the IUGR group received only half of food amount normally consumed by a pregnant female on the corresponding GD. From the day of delivery, the dams of the IUGR group obtained unlimited access to food. On the first day after delivery, the number of pups in each litter was limited to 8. After delivery, the weight of the dam and litter were regularly monitored. At the age of 11 days the linear body sizes of several pups randomly selected from each litter were measured.
Starting from the age of 4 weeks, the offspring of both groups of females were separated from their mothers and 2–4 males were randomly selected from each litter for further experiments. Offspring individual body weight was monitored weekly until the age of 11 weeks. At the age of 12–13 weeks the male rats were killed by decapitation under CO2 anesthesia and trunk blood was collected. Then small mesenteric arteries (2–3-order branches of the superior mesenteric artery) and septal coronary artery were isolated and used for wire myography experiments. Left coronary artery was isolated as well and used for Western blotting and qPCR experiments.
Blood pressure measurements
At the age of 9–10 weeks the systolic blood pressure was determined in male offspring using tail-cuff plethysmography (Systola, Neurobotics, Russia) between 2 p.m. and 6 p.m. The rats were adapted to the experimental environment by performing the same procedures except blood pressure values collection. Four days later after adaptation the systolic blood pressure level was recorded at least five times in each rat and the average value was taken into account. Heart rate values was obtained from plethysmography recordings as well.
Blood samples analysis
Immediately after decapitation the blood glucose level was measured using Diacont express test strips. After blood clotting (20 min at room temperature followed by 40 min at 4 °C) the serum was separated by centrifugation for 15 min at 4300 g and kept at − 20 °C till analysis. Total cholesterol serum concentration, high density lipoproteins (HDL) and low density lipoproteins (LDL) were determined using automatic biochemistry analyzer (A-25 Biosystems, Spain). The NO metabolites levels were measured using Griess method after reduction of nitrates to nitrites by VCl3 39.
Wire myography
Experiments on isolated arteries were performed as previously described 17. Briefly, 2-mm-length segments of small mesenteric and septal coronary arteries were mounted on wires (with a diameter of 40 µm) and placed in myograph system (DMT, Denmark, models 410A or 620M) for isometric force recoding. The preparations were kept at 37 °C in physiological salt solution containing (in mM): 120 NaCl, 26 NaHCO3, 4.5 KCl, 1.2 NaH2PO4, 1.0 MgSO4, 1.6 CaCl2, 5.5 D-glucose, 0.025 EDTA, 5 HEPES, equilibrated with gas mixture 5% CO2 + 95% O2 to maintain pH = 7.4. Transducer readings were continuously recorded at 10 Hz sampling rate using E14-140 analog-to-digital data converter (L-Card, Russia) and PowerGraph 3.3 software (DISoft, Russia). The segments were gradually stretched to 0.9 d100, where d100 is the inner diameter of fully relaxed vessel exposed to the transmural pressure of 100 mmHg 40. At the beginning of each experiment, mesenteric arteries were activated with noradrenaline (10 µM) and then with MX (10 µM), septal coronary arteries were twice activated with U46619 (1 µM). Endothelium-dependent relaxation was examined using acetylcholine (0.01 µM -10 µM) applied on top of MX- or U46619-induced contraction (shown in Fig. 3d, 4d).
The main experimental protocol used in this study consisted of three cumulative concentration-response relationships (CRRs) to MX (0.01 µМ – 100 µM, for mesenteric arteries) or U46619 (0.001 µМ – 3 µM, for coronary arteries) separated by washout periods. First CRRs were performed in order to ensure similar initial responses of studied arterial segments. The second CRRs (shown in Fig. 3a-b, 4a-b ) were obtained after 20-min incubation of one segment with NO-synthase inhibitor L-NNA (100 µМ, Alexis Biochemicals) and the other one with equivalent volume of solvent (H2O, 50 µl). Twenty minutes before the third CRRs (shown in Fig. 3c, 4c), both segments were treated with Y27632 (Rho-kinase inhibitor, 3 µM, Calbiochem) in combination with either L-NNA or solvent, accordingly.
Responses to NO-donor were studied in the additional experimental protocol. After obtaining the concentration-response relationship to MX or U46619 (for mesenteric and coronary arteries, respectively) the segments were incubated for 20 min with L-NNA (100 µМ), in order to exclude the influences of endogenous NO. Then the segments were precontracted with MX or U46619 to 70–80% of the maximum active force and concentration-response relationship to DEA/NO (0.001 µМ − 100 µМ, Sigma) was recorded (shown in Fig. 3e, 4e).
The wire myograph experiments were analyzed as described earlier 17. All active force values were calculated by subtracting the passive force value (recorded in the preparation with fully relaxed smooth muscle) from all recorded values (before the first and at each agonist concentration). Then all active force values in MX- or U46619-induced concentration-response relationships were expressed as a percentage of the maximum active force value recorded in respective first concentration-response relationship. The reactions to acetylcholine or DEA/NO were expressed as percentage of precontraction value. Concentration-response relationships were fitted to a sigmoidal function with variable slope and AUC were calculated using GraphPad Prism 7.0 Software (La Jolla, CA). In order to compare the inhibitor effect between two groups of rats, AUC level in the presence of inhibitor was expressed as the percentage of average AUC level in the presence of solvent in the respective group.
qPCR
qPCR experiments were performed similarly to previously described 41. Briefly, left coronary arteries were isolated, immediately placed in RNA-later solution (Qiagen) and kept at -20˚C pending further procedures. RNA was extracted using ExtractRNA kit (Evrogen, Russia) according to the manufacturer’s instructions. All RNA samples were processed with DNase I (Fermentas). RNA concentration was measured by a NanoDrop 1000 (Thermo Scientific, USA) and thereafter all samples were diluted to the same concentration. Reverse transcription was performed using the MMLV RT kit (Evrogen, Russia) according to the manufacturer’s protocol. qPCR was run in the RotorGene6000 using qPCRmix-HS SYBR (Evrogen). mRNA expression level was calculated as E− Ct, where E – primer efficiency and Ct – cycle number on which the curve for product accumulation is crossing the fluorescence detection threshold (calculated using the RotorGene6000 software). This value was normalized to the geometric mean of the two housekeeping genes (Gapdh and Rn18s), detected in the same sample and expressed as the percentage of the mean value of the control group.
Primers were synthetized by Evrogen and had the following sequences: Gapdh (forward: CACCAGCATCACCCCATTT; reverse: CCATCAAGGACCCCTTCATT), Rn18s (forward: CACGGGTGACGGGGAATCAG; reverse: CGGGTCGGGAGTGGGTAATTTG), Arg2 (forward: CCAGCCTAGCAGTGGATGTGA; reverse: CTCTGGAATGCTGTCGTGAA).
Western Blotting
Western blotting experiments were performed similarly to previously described 17. In brief, left coronary arteries were isolated and frozen in liquid nitrogen pending further procedures. To obtain one sample, 2 left coronary arteries from 2 animals were combined. Then they were homogenized in SDS-buffer (0.0625 mol/l Tris-HCl (pH 6.8), 2.5% SDS, 10% water-free glycerin, 2.47% dithiothreitol, 0.002% bromophenol blue) supplemented with protease and phosphatase inhibitors (aprotinin 50 mg/ml, leupeptin 100 mg/ml, pepstatin 30 mg/ml, NaF 2 mg/ml, Na3VO4 180 mg/ml), centrifuged at 16000 g for 5 min at 4°С; supernatant was kept at -20°С. Proteins were separated by SDS-PAGE and transferred to nitrocellulose membrane (Santa Cruz) using Trans-Blot Turbo transfer system (BioRad). The transfer was visualized with Ponceau S staining and the membrane was cut in three parts at the levels of appr. 28 and 75 kDa protein marker (Abcam). All parts were blocked with 5% nonfat milk (Applichem, Germany) in TBS (20 mmol/l Tris-HCl, pH 7.6; 150 mmol/l NaCl) with 0.1% Tween 20 (TBSt). Then the lower part of the membrane was incubated overnight with antibodies against SOD I (Sigma-Aldrich, rabbit, 1:4000 in TBSt with 5% milk), SOD II (Enzo, rabbit, 1:1000 in TBSt with 5% milk) or RhoA (Abcam, rabbit, 1:2000 in TBSt with 5% milk). The middle part was incubated overnight with antibodies against GAPDH (Abcam, mouse, 1:2000 in TBSt with 5% milk). The upper part was incubated overnight with antibodies against Rho-kinase II (Abcam, rabbit, 1:5000 in TBSt with 5% milk) or eNOS (BD Transduction Lab, mouse, 1:2000 in TBSt with 5% milk). The next day, all membranes were incubated with appropriate secondary antibodies: anti-mouse (Cell Signaling, 1:5000 in 5% milk in TBSt) or anti-rabbit (Cell Signaling, 1:10000 in 5% milk in TBSt) for 1 hour and visualized with Super Signal West Dura Substrate (Thermo Scientific) using ChemiDoc (BioRad). Western blotting experiments were analyzed in ImageLab Software (BioRad). Protein of interest to GAPDH ratio was identified in each sample, and then the average ratio in control group was taken as 100%.
Statistical data analysis
Statistical analysis was performed in GraphPad Prism 7.0. Unpaired Student’s t-test or two-way ANOVA were used, as appropriate. Statistical significance was reached at P < 0.05. All data are given as mean ± S.E.M.; n represents the number of animals or the number of samples in Western blotting experiments.