Specific Antibiofilm of Carbon Quantum Dots by Destroying P. gingivalis Biofilm Related Proteins Self-assembly

doi:10.21203/rs.2.23633/v1

Download PDF

Research

Specific Antibiofilm of Carbon Quantum Dots by Destroying P. gingivalis Biofilm Related Proteins Self-assembly

https://doi.org/10.21203/rs.2.23633/v1

This work is licensed under a CC BY 4.0 License

Version 1

posted

You are reading this latest preprint version

Biofilms protected bacteria from antibiotics and produced drug-resistant strains, especially the main pathogen of periodontitis- Porphyromonas gingivalis ( P. gingivalis ). In this investigation, the carbon quantum dots (TCDs and MCDs) were prepared by hydrothermal method with clinic antibacterial drug-Tinidazole and Metronidazole and exhibited unique antibiofilm properties. The transmission electron microscope (TEM) images showed that the TCDs and MCDs had uniform sizes and the results of UV-vis and energy dispersive spectrometer (EDS) confirmed their important carbon polymerization structures. The prepared TCDs and MCDs were characterized by infrared spectroscopy and still kept the activity of nitro group, which still had an obvious effect on P. gingivalis . Interestingly, the results showed that they both have significant antibacterial effect on P. gingivalis , while the effect of TCDs was better than MCDs. However the TCDs has almost ineffect on other bacteria including Escherichia coli ( E. coli ), Staphylococcus aureus ( S. aureus ) and Prevotella nigrescens ( P. nigrescens ), the MCDs still have obviously antibacterial ability to P. ningrescens . Importantly, the TCDs can penetrate the biofilms to further effectively inhibited the growth of P. gingivalis under the biofilms. Furtherly, we revealed the hydrophilic TCDs destroy P. gingivalis ’ adhesion and impair toxicity by inhibiting the major virulence factors and related genes involved in biofilm formation of P. gingivalis, thus affect the self-assembly of biofilm related proteins. The findings may not only develop a new promising method for improve the periodontitis treatment efficiency by penetrating P. gingivalis biofilm with preparation of nano-level antibacterial drugs.

Nanoscience

P. gingivalis

Carbon dots

Tinidazole

Biofilms

Penetration

Porphyromonas gingivalis (P. gingivalis), a gram-negative anaerobic bacterium, is deemed as a keystone oral pathogen, main pathogen of chronic periodontitis, which is related to the occurrence and development of periodontitis. The prevalence of P. gingivalis is common in adults, and the severity of P. gingivalis-related oral diseases increases with age [1-3]. An abnormal increase of P. gingivalis can lead to an imbalance of oral micro-ecology. In this context, the bacteria are highly pathogenic and spread throughout the body through blood circulation, and would cause systemic diseases such as cardiovascular disease, hypertension, diabetes, preterm birth and pneumonia [4-6]. Moreover, the accumulation of P. gingivalis in oral squamous cell carcinoma was significantly higher than that in normal oral mucosa [7, 8], suggesting that P. gingivalis is associated with oral squamous cell carcinoma. Our group found that P. gingivalis infection may also be a risk factor for esophageal squamous cell cancer (ESCC) [9]. Another prospective study also showed that P. gingivalis enrichment is highly correlated with ESCC risk [10]. In addition, P. gingivalis infection has a certain relationship with colorectal cancer and pancreatic cancer [11, 12]. The latest research found that P. gingivalis infection is also associated with Alzheimer's disease [13]. These investigations suggest that P. gingivalis infection has a close relationship with many diseases and may play an important role in the progression of these diseases. Therefore, it is very important to eliminate P. gingivalis for the treatment of oral and other related diseases.

Most of the drugs currently used to kill bacteria are antibiotics, such as nitroimidazoles, tetracyclines, etc. However, it’s effect is very limited because most antibiotics used in clinical context can only maintain high efficiency over a short time, and resistant strains will soon occur due to continuous use of antibiotics. The main reason for this dilemma is that the biofilm produced from the bacteria, a membrane-like structure composed of microbial cells and extracellular polymer complexes surrounded by exopolysaccharides on biotic or abiotic surfaces [14-16], which protected bacteria under the biofilm from antibacterial agents and host defense mechanisms and subsequently makes the drug failure [17], also in turn triggers bacterial resistance [18-20]. In addition, although antibiotics can inhibit the symptoms of present infection by killing exfoliated zooplankton in vivo, but antibiotic cannot eradicate bacteria located in the deep embedded biofilm [21]. When antibiotics are discontinued, biofilms can be used as a recurrent lesion of infection [21-23]. Current research has confirmed that more than 80% infectious diseases are closely related to biofilms [24-26]. For example, dental plaque on the teeth was caused by the presence of biofilm produced by P. gingivalis, which block antibiotics penetrating the biological barrier and protect the bacteria from eradicating by therapeutics [27-29]. Even increasing the dose of the drug will only upturn the tolerance to them [24, 30]. Therefore, to develop a drug capable of breaking down the biofilm is becoming a big challenge.

With the development of nanomedicine, nanomaterials have been developed as antibacterial agents to treat bacteria infectious diseases, including antimicrobial peptides, inorganic nanoparticles, natural molecule drug agents [31-34], and carbon quantum dots in particular, which has the advantage in their smaller size and displays an excellent efficiency in dealing with biofilms related infections [35-37]. As a new type of nanomaterials, carbon quantum dots (CDs), have attracted considerable attentions due to their unique properties, such as superior optical properties, high photostability, good water solubility, low toxicity, biocompatibility and cell permeability [38-40], as well as convenient preparation and modification. In recent years, CDs have been synthesized using several methods including chemical ablation, electrochemical carbonization, laser ablation, microwave irradiation and hydrothermal treatment. The hydrothermal method for CDs preparation is simple, green, and one-step synthesis [41, 42]. and a variety of raw materials have been prepared for carbon quantum dots for research using this method, such as special materials graphene, citrate and interesting materials including candle soot and natural gas sootetc [43-45]. Small-molecule drugs with a complete carbon-framework structure are also being used to make functional CDs [11, 46]. However, novel drugs that selectively target pathogenic species would offer an alternative to currently overused broad-spectrum antimicrobials [47]. Liu et al chose Metronidazole as the sole carbon source to prepare, nontoxic, highly photo luminescent (PL) nano-carbon dots with selective antibacterial activity against obligate anaerobes [40]. As an upgrade version of Metronidazole, Tinidazole have good activity against gram-negative anaerobic bacteria and show more sensitivity than Metronidazole to anaerobic bacteria. Inspired by this, we speculated that the carbon dots from Tinidazole have an uniform nanometer size and the similar function of Tinidazole, so that the effect of the drug can be maximized, and even it can penetrate the biofilm to kill bacteria.

In this study, we developed the simple hydrothermal method to synthesize CDs from Tinidazole (TCDs) and Metronidazole (MCDs), respectively, and compared the antibacterial effects of TCDs and MCDs. The TCDs and MCDs were characterized by infrared spectroscopy and still retained the activity of the nitro group, which had obviously specific toxicity for P. gingivalis. The TEM images showed that both TCDs and MCDs had uniform sizes and good monodispersity. The results of UV-vis and EDS confirmed their important carbon polymerization structure, indicating that the nanodrugs were successfully prepared. Next, we evaluated the selective antibacterial activity of TCDs or MCDs and further investigated the anti-biofilm effect of TCDs in a P. gingivalis biofilm model in vitro. Using the first biofilm breakthrough model constructed for biofilm penetration by TCDs, we revealed that the specific anti-biofilm activity of TCDs was achieved by inhibiting the major virulence factors and related genes involved in biofilm formation of P. gingivalis, thus affect the self-assembly of biofilm related proteins. Ultimately, TCDs can further effectively eliminate P. gingivalis following biofilm penetration.

Materials

Tinidazole and Metronidazole (99.0%) were purchased from Shanghai Aladdin Reagent Co. Ltd. Liquid medium for P. gingivalis: Gifu Anaerobic Medium Broth (GAM, Nissui, Tokyo, Japan) with 5% Defibrinated Sheep Blood and 1 mg/mL vitamin K1 (Sigma-Aldrich, St. Louis, MO, USA) and treated by high temperature steam sterilization. Luria Bertani (LB) was formulated with Tryptone (Sigma-Aldrich), Yeast extract (Sigma-Aldrich) and NaCl (Sigma-Aldrich) for E. coli and S. aureus.

Synthesis of MCDs and TCDs

TCDs and MCDs were prepared by hydrothermal methods according to previous reports [39, 40]. Briefly, 5 mmol of Metronidazole or Tinidazole was completely dissolved in 20 mL ultra-pure water. After stirring for 15 min, the solution was transferred to a 100 mL Teflon-lined autoclave, which was sealed and incubated at 200 °C for 6 h, and then for another 12 h. Subsequently, the mixture was cooled down to room temperature. Afterwards, the pale-brown solution was filtered through a 0.22 μm polyethersulfone membrane to remove agglomerated particles and dialyzed in a 800 Da dialysis bag against ultra-pure water for 24 h. Lastly, the resultant liquid was freeze-dried overnight to form a solid sample (MCDs and TCDs) for further characterization.

Characterization of MCDs and TCDs

FTIR spectra of TCDs and MCDs were recorded on a Nicolet 200 type Fourier transform infrared spectrometer (Thermo Nicolet, USA). The transmission electron microscopy (TEM, JEM-2100F) was employed to characterize the TCDs or MCDs. The scanning electron microscope (SEM) and energy dispersive spectrometer (EDS) patterns of the MCDs and TCDs were performed on a S-3400N scanning electron microscope (Hitachi, Tokyo, Japan). The size distribution of the nanoparticles was determined by Zetasizer Nano ZS instrument (Malvern, UK). UV-Vis absorption spectra were obtained using a Shimadzu 3100 UV-Vis spectrophotometer. The fluorescence emission spectrum of TCDs and MCDs were analyzed on a Hitachi Flworomax-4 fluorescence spectrometer.

Cell Cytotoxicity of MCDs and TCDs

Human immortalized liver cell (L0-2) line was purchased from the Shanghai Cell Bank of the Chinese Academy of Sciences and used for assessment of the cytotoxicity of MCDs and TCDs. The cells were cultured in Roswell Park Memorial Institute-1640 Medium (RPMI-1640) supplemented with 10% fetal bovine serum at 37 °C under 5% CO₂. The 3-(4,5-dimethyl-2-thiazolyl)-2,5-diphenyl-2-H-tetrazolium bromide, methylthiazolyltetrazolium (MTT) viability assay was performed to evaluate the cell cytotoxicity of MCDs and TCDs on L0-2 cells. Briefly, L0-2 cells (5×10⁴/well) were seeded in a 96-well cell culture plate at 100% humidity, and cultured at 37 °C in 5% CO₂ for 24 h before exposure to nanoparticles; then, the cells were treated with different concentrations of MCDs or TCDs for another 24 h. Thereafter, 10 μL of 5 mg/mL MTT (0.5 mg/mL)was added to each well, after incubating, 150 μL of DMSO was added to each well, and shaken until the crystal sufficiently melted. The absorbance of each well was determined by selecting the wavelength of 490 nm on an enzyme-linked immunosorbent monitor, and the results were recorded and repeated twice for the MTT assay. The cell viability was calculated as:

Cell viability = OD_experiment/OD_Control× 100%

Antibacterial assay of MCDs and TCDs

The minimum inhibitory concentration (MIC) is often used as an important indicator of antibacterial research [48]. In this study, we tested the MIC of TCDs or MCDs for the selective sterilization in P. gingivalis, P. nigrescens, E. coli and S. aureus. Briefly, P. gingivalis were purchased from American Type Culture Collection (ATCC) and cultured using GAM medium in an anaerobic incubator (atmosphere of 5% CO₂, 10% H₂, 85% N₂, 37 °C) for 24 h. The number of P. gingivalis (1×10⁹CFU/mL) is calculated by OD 600 nm and P. gingivalis suspension (5×10⁷CFU/mL) was prepared. Each well of 96-well flat-bottomed plastic non-tissue culture plates were inoculated with 100 μL of P. gingivalis suspension with GAM medium, and cultured in an anaerobic incubator (atmosphere of 5% CO₂, 10% H₂, 85% N₂, 37 °C) for 24 h. 100 μL of different concentrations of MCDs and TCDs from 0 μg/mL to 125 μg/mL were added into above mentioned plate. In parallel, 100 μL of liquid medium or 100 μL of MCDs or TCDs were added into the plate serving as the blank control respectively. Bacterial growth was recorded at full wavelength microplate reader. Staphylococcus aureus (S. aureus) and Escherichia coli ATCC25922 (E. coli) and P. nigrescens were treated in a similar manner as above.

Inhibition (%) =OD_experiment/OD_control×100%

Inhibition zone assays were performed according to previous reports. In brief, 50 μL of P. gingivalis (1×10⁹CFU/mL) were evenly spread on solid medium in an anaerobic incubator (atmosphere of 5% CO₂, 10% H₂, 85% N₂, 37 °C) for 1 h. During cultivation, the sterile circular filter papers with a diameter of 10 mm were fully immersed in the solution of nanoparticles for 1 h, then placed on the solid medium plate and cultured for 24 h. Finally, count the size of the inhibition zone and the result was recorded by CCD camera. S. aureus and E. coli and P. nigrescens were treated in the same manner as P. gingivalis did.

Biofilm formation and detection

The assay for biofilm formation and detection were adapted from the procedure described previously study [49, 50]. P. gingivalis suspension (5×10⁷CFU/mL) with 1% glucose was prepared and 96-well flat-bottomed non-tissue culture plate were inoculated with 100 μL of P. gingivalis suspension. 24 h culture in an anaerobic incubator (atmosphere of 5% CO₂, 10% H₂, 85% N₂, 37 °C) was allowed for biofilm formation. After cultivation, the 96-well plate was washed three times with phosphate buffer saline (PBS) to remove the non-adherent P. gingivalis cells. Then 100 μL of methanol was added into each well to fix biofilms for 10 min. After fixing, the plate was washed three times and air-dried at room temperature, stained with 0.1% (w/v) Crystal Violet (Sigma-Aldrich) and rinsed thoroughly with PBS until negative control wells appeared colorless. Then, the plate was decolorized with 150 μL 95% (v/v) ethanol. and the absorbance was quantified through measuring the optical density by using an microplate reader.

The assay for inhibition of P. gingivalis biofilm formation was adapted from the procedure described previously. Briefly, 96-well flat-bottomed non-tissue culture plate was inoculated with 100 μL of P. gingivalis suspension (5×10⁷CFU/mL) with 1% glucose and cultured in an anaerobic incubator for 24 h. After that, the plate was treated with different concentrations of TCDs (from 0 μg/mL to 125 μg/mL) to challenge the biofilm forming ability of P. gingivalis for another 24 h followed by measurement of absorbance as above.

Confocal Laser Scanning Microscopy (CLSM) Assay

The P. gingivalis suspension (5×10⁷ CFU/mL) with 1% glucose were added to a confocal dish and statically cultured in an anaerobic incubator (atmosphere of 5% CO₂, 10% H₂, 85% N₂, 37°C) for 48 h to form a biofilm on the glass substrate, separately. After the mature biofilm was formed, which was carefully washed twice with sterile PBS, and different concentrations of TCDs were added to the dishes for 24 h. Biofilms and P. gingivalis were detected by fluoresceine isothiocyanate (FITC) staining method, specifically, the dishes were stained in the dark for 30 min at 37 °C, and washing three times after staining. Finally, using Zeiss LSM780 confocal laser scanning microscope (CLSM; Carl Zeiss, Jena, Germany) and LSM 780 ELYRA PS.1 super-resolution structural lighting system and 63 × flat color oil immersion objective lens (numerical aperture, 1.46). Acquire and analyze images using ZEN 2011 software.

Biofilm penetration model

To test whether TCDs can penetrate the biofilm and inhibit growth of P. gingivalis under the biofilm. The biofilm model was constructed for biofilm penetration assay in vitro as shown in Fig. 8 a. Firstly, a 0.22 μm basement membrane were applied onto the bottom of the upper chamber followed by perfusion with P. gingivalis (5×10⁶CFU/mL), and culture for 48 h, allowing biofilm formation on the upper chamber. After successful formation of the biofilm, different concentrations of TCDs were added into the upper chamber overlying the 24-well plate. And the P. gingivalis were cultured in the bottom chamber for another 24 h.

In vitro adhesion model

It is known that P. gingivalis can adhere to teeth and form biofilms in an anaerobic environment, which make up the basis of dental plaque [3, 51]. Therefore, the effect of TCDs on plaque adherence was determined using single-channel direct-rooted teeth. The teeth from adult cattle were directly washed with saline solution, 3 mL of 25.5% sodium hypochlorite and then 3 mL 17% EDTA to remove the smear layer.[52] After washing, the teeth were autoclaved at 121 °C for 30 min and then immersed in normal human oral saliva filtered by 0.22 μm filter. Thereafter, the teeth were added in the P. gingivalis suspension (1×10⁸ CFU/mL) with various concentrations of TCDs and incubated anaerobically for 48 h. Subsequently, the samples were washed with PBS to remove non-adherent bacteria. Finally, the biofilm formed on the teeth surface was measured by staining with 0.1% safranin.

Bacterial hydrophobicity assay

Hydrocarbon-xylene test was used to evaluate the bacterial hydrophobicity [53]. Briefly, P. gingivalis were cultured anaerobically in the presence of TCDs. After that, Potassium-Urea-Magnesium buffer (PUM) buffer were used to wash the bacteria twice, bacteria were diluted to obtain final OD_a (490 nm,). bacterial solution then xylene were mixed in equal volume and the mixtures were agitated uniformly for 90 s. After allowing 30 min for the hydrocarbon phase to rise completely, the aqueous phase was carefully removed and determined OD_bat 490 nm, using a full wavelength microplate reader.

Bacterial hydrophobicity (%) = 100% × (OD_a – OD_b)/OD_a

Gene expression of biofilm related gene

In order to evaluate the mechanism of TCDs to interfere the formation of P. gingivalis biofilm, the key genes involved in biofilm formation by P. gingivalis, including FimA, RgpA, RgpB and KGP were investigated [48, 54, 55]. Gel assay was used to quantify mRNA expression levels of these genes. An overnight cultured P. gingivalis (1×10⁹CFU/mL) were diluted ten times as a bacterial suspension, seeded in two polystyrene flat-bottom 6-well plates at 100 μL per well. The different concentrations of TCDs were applied subsequently with PBS-treated group served as a control and then cultured under anaerobic conditions until the biofilm formation was detected on the control plate. Then, TriZol was used to extract total RNA from P. gingivalis. The RNA was reverse transcribed using the RTase according to the manufacturer's protocol (Catalog No. 4374966; Thermo Fisher Scientific, CA, USA) with DEPC treated water. The reverse transcript primers used in this reaction system are listed in Table 1.

Subsequently, 1 μL of the reverse transcript cDNA was added to the PCR system with 1 μL of the forward and reverse primer, respectively, and finally PCR mix was added to the reaction system up to a total of 20 μL. The reaction system was amplified 32 cycles at 95 °C for 15 s, 60 °C for 30 s and 72 for 30 s.

For PCR production detection, 10 μL of amplified DNA with 5×loading buffer were added into 1% agarose gel for electrophoresis separation at 80 V for 40 min. The intensity of image bands was analyzed by Image J for quantitative analysis.

Statistical Analysis

All statistical analyses of experiment results were evaluated using two-tailed, unpaired student’s t-tests. The statistical analyses were conducted using SPSS 23.0 version statistical software. P-values <0.05 were considered statistically significant.

Characterization of MCDs and TCDs

In this study, we synthesized TCDs and MCDs based on anti-anaerobic drugs Tinidazole and Metronidazole, respectively, through a simple green hydrothermal synthetic method [20, 56]. The TEM images and the size distribution by Dynamic Light Scattering (DLS) of TCDs in (Fig. 2 a1 ,b1) and MCDs in (Fig. 2 a2 ,b2) illustrated that the size of TCDs is almost uniform with 16.5 nm and 15.1 nm as the predominant diameters for TCDs and MCDs, respectively. Furthermore, the nanoparticles retained the uniform hydrodynamic size in water. Fig. 2 c1 show the UV-Vis spectra of TCDs and Tinidazole, and Fig. 2 c2 showed the UV-Vis spectra of MCDs and Metronidazole. The pro-drug Tinidazole exhibited two broad absorption peaks at 227 nm and 315 nm, ascribed to π–π*(C=N) and n–π*(C–N-C), respectively. While the prepared TCDs showed only one peak at 287 nm, which could be credited to n–π* (C–O). The result of MCDs and Metronidazole in Fig. 1 c2 is consistent with previous research reports [40].

Then the elemental composition and main functional groups of TCDs and MCDs were identified, respectively. The results of EDS spectra of Tinidazole and TCDs (Fig. 3a1, b1) indicated that the TCDs was mainly consisted of carbon (61.0 atomic percentage (at) %), nitrogen (14.2 at%) oxygen (20.7 at%) and sulfur (4.1 at%). However, the Tinidazole mainly comprised of carbon (54.1 at%) and nitrogen (20.4 at%), which demonstrated that the content of carbon rose after the reaction and the carbon polymerization of TCDs, indicating the successful synthesis of carbon dots. In addition, as shown in Fig. 3 a2, b2, the element composition of the metronidazole included (C (48.76 at%), O (26.43 at%), N (24.81 at%)) before reaction, but the MCDs was mainly consisted of C (59.43 at%), O (22.35 at%), N (18.22 at%) after preparation, which was consistent with the results of TCDs. Then the photoluminescence (PL) properties of TCDs and MCDs were measured with the excitation wavelengths from 380 nm to 480 nm. As shown in Fig. 3 c1, the TCDs have an excellent emission intensity at the excitation of 400 nm and the emission wavelength of 492 nm. And the insert image in Fig. 3 c1 presenting the TCDs showed blue-green fluorescence with 492 nm. In Fig. 3 c2, the optimal emission of TCDs was at 463 nm under 400 nm excitation. The FTIR spectra (Fig. 3 d1) of Tinidazole exhibited the absorption bonds at 3420, 3161, 1611–1511, 1369,1131–1264 cm⁻¹, which was attributed to the stretching vibrations of v(N–H), v(=C–H), v(–NO₂) and v(C–N). Furthermore, some original functional groups were still retained under high temperature and high pressure through the analysis of the FTIR spectrum of the TCDs (Fig. 3 d1), such as stretching vibrations of N-H at around 3417 cm⁻¹ with strong and broad absorption peaks, which may be caused by the bending vibrations of N–H, the bonds at 1540–1470 cm⁻¹ and 1010–1090 cm⁻¹ corresponded to C–N and C–H, respectively. The results of metronidazole and MCDs in Fig. 3 d2 resemble previous findings [40]. The formation of these chemical bonds was mainly due to the physical change and chemical reaction processes. Notably, -NO₂ was also detected in TCDs, but its relative content in nanoparticles was lower than that in Tinidazole, perhaps some of them were reduced. It has been reported that anaerobic bacteria can reduce the nitroimidazole nitro group to hydroxylamine by electron transfer protein, which further leads to reaction with bacterial proteins and DNA to prevent the synthesis of all nucleic acids [9, 10, 40]. These results demonstrated that TCDs were successfully prepared through a simple and green hydrothermal method and still retain the possibility of selective bacteriostatic ability [40].

Biocompatibility of TCDs and MCDs

Obviously, good biocompatibility and low toxicity of nanomaterials are excellent indicators for biomedical applications. For this purpose, normal human liver L0-2 cells were treated with different concentration of MCDs and TCDs for biocompatibility assay. Fig. 4 showed that the viability of L0-2 cells was more than 80% after 24 h of incubation with TCDs, even when the concentration reached 100 μg mL⁻¹. But the survival of L0-2 cells treated with MCDs below 80% at the same concentrations MCDs. These results demonstrated that TCDs exhibited good biocompatibility and low toxicity.

Selective inhibition of bacterial growth by TCDs and MCDs

As a commonly used antibacterial drug, Metronidazole and Tinidazole are specially effective for gram-negative and anaerobic bacteria [9, 57]. Therefore, we tested the specific inhibitory effect of TCDs and MCDs on proliferation of different bacteria. E. coli, S. aureus, P. gingivalis and P. nigrescens were selected for test the inhibitory zone with different concentrations of TCDs or MCDs. As shown in (Fig. 5 a1-2, b1-2) there were no obvious inhibitory zones formed around the filter paper treated with TCDs or MCDs on the (E. coli and S. aureus) bacterial plats. However, obvious inhibitory zone for P. gingivalis were observed around filter papers treated with TCDs and MCDs, respectively (Fig. 5 d1, d2). It should be note that the MCDs had a significant inhibition on P. nigrescens (Fig. 5 c2), on the contrary, the TCDs in (Fig. 5 c1) had a weaker effect than MCDs on P. nigrescens. To further determine the effect of TCDs and MCDs on the inhibition of the bacteria, different concentrations of TCDs and MCDs were added into liquid media by examining the OD value to monitor the growth of the bacteria. In Fig. 5 e-h, the results showed that the TCDs and MCDs had no significant inhibitory effect on E. coli (Gram-negative bacteria) and S. aureus (Gram-positive bacteria) growth, however the TCDs and MCDs both showed excellent antibacterial effects against P. gingivalis growth, consistent with the results of the above inhibition zone experiments. Simultaneously, the MCDs (Fig. 5 g) still had bactericidal activity against P. nigrescens, while the TCDs only showed weaker inhibition on P. nigrescens. These results confirmed that TCDs had extraordinary bactericidal activity against P. gingivalis and showed no significant inhibition on other gram-negative anaerobic bacteria. As expected, TCDs exhibited better specificity inhibition than MCDs for P. gingivalis growth, and the antibacterial effects of TCDs which depended to large extent on the antibacterial activity of the nitro group [40].

The antimicrobial susceptibility of P. gingivalis to TCDs and MCDs were evaluated by measuring the MIC values. The result of TCDs (Fig. 6 a) demonstrated that the TCDs have remarkable antibacterial ability in P. gingivalis and provided the minimum use concentration for further research. We observed that the growth of P. gingivalis at low concentrations slower than the control group, even when the concentration reached 25 μg/mL, the bacterial growth was nearly completely inhibited and then the growth was declined as the concentration was further increased. While in Fig. 6 b when the concentration of MCDs reached 50 μg/mL, the growth of P. gingivalis treated with MCDs became stationary, and no significant bactericidal activity were emerged until using higher concentrations. However, higher drug use concentrations could lead to bacterial resistance and biocompatibility declined, which ultimately resulted in the limited of applications [6]. Therefore, the TCDs were selected for further research, and these results laid the foundation to further explore the anti-biofilm activity and mechanism of TCDs.

The inhibition effect of TCDs on P. gingivalis biofilm formation

Biofilms could wrapped microorganisms and protected them from the killing of drugs, the protective function were afforded by the extracellular matrix (ECM) and several types of biomolecules (polysaccharides, DNA, and peptides). Because of the protective function of biofilms, the P. gingivalis behave durable resistance and viability, which increased the difficulty of treating oral related diseases [2, 3]. Semi-quantitative analysis of crystal violet is a method for judging the amount of biofilm produced by bacteria through decolorization detection after staining their biofilm by using crystal violet [7]. The biofilm formation experiment results (Fig. 7 a) illustrated that when the number of P. gingivalis at 5×10⁶ CFU/mL, the biofilm biomass was detected in higher formation which compared with the control group, however, the amount of biofilm formation did not increase as the amount of bacteria increased in 7.5×10⁶even 1×10⁷CFU/mL. We speculated that the growth of biofilm was reduced because of the limited growth space for P. gingivalis. Simultaneously, it provided a reliable reference value for the quantity of bacterial mass to formed a complete biofilm. The images of P. gingivalis biofilms stained with crystal violet after TCDs treatment shown in Fig. 7 b and Fig. 7 c. the first well completely maintained the production of biofilms without the TCDs treatment, and then the production of biofilms gradually decreased with the increased concentrations of TCDs, and almost completely inhibited the formation of biofilm at the concentration of 150 μg/mL, which was consistent with previous reports [58]. Although Tinidazole also can inhibited the formation of biofilm, but the effect was not as obviously as TCDs (Fig. 7 b, 7 c).

In order to more intuitively evaluate the effect of TCDs on P. gingivalis biofilm formation, we employed confocal laser scanning microscope (CLSM) to analyze the clearance and permeability of different concentrations of TCDs on FITC-labeled P. gingivalis and formation biofilms in 3D and orthogonal fields [12]. As shown in the Fig. 8 a, a dense biofilm was observed in the 3D field of untreated group, and the corresponding orthogonal field of view also showed a higher biofilm thickness. On the contrary, the incomplete biofilms was observed on the surface of confocal dish treated with TCDs of 25 μg/mL, and with the concentration increased, the number of biofilms on the bacteria attached to the surface of dish decreased significantly, and the result of relative quantification for biofilm biomass from fluorescence intensity showed that the biofilms reduced by 75% when the concentration of TCDs reached 200 μg/ml (Fig. 8b). In addition, the quantitative results for average biofilm thickness showed that the relative thickness nearly decreased to 5.4 μm (Fig. 8 c). Therefore, TCDs showed an excellent effect in inhibiting biofilm formation.

Penetration of TCDs to biofilm and inhibit P. gingivalis growth

The target bacteria can escape from the large-scale antibiotics killing owing to common drug particles unable to across the grumous biofilm [8]. As far as we know, there is no biofilm penetration sterilization study have been reported before. Firstly, we constructed a biofilm model for biofilm penetration sterilization experiments in vitro (Fig. 9 a). The 0.22 μm filter membrane were paste on the bottom of the upper-chamber used as basement on which the P. gingivalis were cultured, and then added 1×10⁷ CFU of bacteria and cultured for 48 h to form biofilm on the chamber. When the biofilm model successfully formed, different concentration of TCDs were added into the upper-chamber, as shown in Fig. 9 b, the growth of P. gingivalis cultured in the down-chamber were significant inhibited, suggesting that TCDs could penetrate the biofilm and inhibit the growth of P. gingivalis cultured in the down-chamber. It should be noted that when the concentration of TCDs is below 50 μg/mL, there was no obvious inhibition effect on the growth of P. gingivalis. Interestingly, the concentration above 50 μg/mL of the TCDs showed significantly antibacterial activity on P. gingivalis compared with the control. while Tinidazole does not kill P. gingivalis cultured in the down-chamber. Therefore, we speculated that the TCDs could across the biofilm and caused lethality to bacteria at higher concentration. Furthermore, as shown in Fig. 9 c1-e1 were SEM images of P. gingivalis biofilm treated with different concentrations of TCDs or Tinidazole. The result demonstrated that a dense biofilm with many long strips of fibers on the surface was formed after 72 h incubated with P. gingivalis. After treated with different concentration of TCDs, small pores produced, which facilitating the penetration of TCDs to the biofilm. When the concentration of TCDs reached to 100 μg/ml, the biofilm was destroyed severely (Fig. 9 c1-e1). While Tinidazole does not displayed drastically effect on the biofilm. Therefore, the nanostructures of TCDs may play an important role in penetrating the biofilms by affecting P. gingivalis producing Fibrin, the important components of mature biofilms [16].

The effect of TCDs on the adhesion of P. gingivalis

The adhesion of the P. gingivalis on dental surfaces was tested in the presence of different concentrations of TCDs and Tinidazole. As showed in Fig. 10 a and 10 b, the adhesion of P. gingivalis was influenced in all the experiments that treated with TCDs from the 12.5 to 200 µg/mL, mean time the stained adherent bacteria in the Tinidazole treatment group did not observed obviously differences compared with the TCDs treatment group. The results revealed that the adherence of P. gingivalis had highly sensitivity to the TCDs, while untreated group had no inhibitory effect on adherence activity of P. gingivalis, similarly, the Tinidazole treatment group hardly to affect the adhesion.

Studies have shown that changes in bacterial surface hydrophilicity can cause alterations in bacterial adhesion. Subsquently, we investigated the effect of TCDs on the hydrophilicity of P. gingivalis. As shown in Fig. 10 d, when the concentration of TCDs increased, the concentration of P. gingivalis in the oil phase was reduced, indicating that the surface hydrophobicity of the bacteria was continuously decreasing, similarly, the absorbance of P. gingivalis in water treated with TCDs significant higher than that of in oil, which was in stark contrast to the pro-drug Tinidazole (Fig. 10 c), suggesting that hydrophilic TCDs can increase the hydrophilicity of P. gingivalis and thus reduce the adhesion of bacteria on biofilms, which consistent with previous reports [53, 59].

Effect of TCDs on genes related with biofilm formation of P. gingivalis

P. gingivalis biofilm formation was regulated by multiple genes. Among them, the long fimbriae (FimA) encoded by FimA play a key role in the adhesion of P. gingivalis, and also affect the formation of biofilm [4, 5]. In addition, arg-gingipain (RgpA, RgpB) and lysine-specific cysteine proteases (Kgp), which are also essential for the processing and maturation of FimA proteins, thus promoting adhesion of P. gingivalis to host tissues. The FimA, Rgp (A, B) and KGP genes were decisive for the pathogenicity of P. gingivalis and also affect the important component of biofilms –Lipopolysaccharide (LPS) [60, 61]. Therefore, we detect the mRNA expression of related genes in P. gingivalis treated with different concentration of TCDs. As shown in Fig. 11, the semi-quantitative analysis results showed that the mRNA expression of FimA RgpA, RgpB and KGP decreased drastically. Therefore, we speculate that the protein expression of FimA, Rgp (A, B) and KGP will be decreased correspondingly, thus affecting the self-assembly of Proteins and preventing formation of biofilms [62].

In summary, the carbon quantum dots drug (TCDs and MCDs ) were successfully synthesized from antibacterial pro-drug-Tinidazole and Metronidazole by hydrothermal method and exhibited unique specificity antibacterial properties. They were characterized by TEM, visible fluorescence spectrum and UV-vis absorption, which determined the TCDs has better benefits contrast to the MCDs. More importantly, the TCDs and MCDs still retained the main bactericidal functional group -NO₂and presented low toxicity, good water-solubility, fluorescent ability. Because of these characters, the TCDs demonstrated specific antibacterial activity against the P. gingivalis. Furthermore, our work confirmed that the hydrophilic TCDs had an excellent effect on inhibiting P. gingivalis biofilm formation. Simultaneously, we construct a biofilm model for biofilm penetration killing experiments at the first time in vitro. The nanoscale TCDs passed through the biofilm to induce significant inhibitory activity on P. gingivalis under the biofilm. Furtherly, we revealed that the TCDs affect P. gingivalis’ adhesion and toxicity by inhibiting the major virulence factors and related genes involved in biofilm formation of P. gingivalis, thus affecting the self-assembly of proteins and preventing formation of biofilms. Consequently, the successful preparation of TCDs may not only develop a promising method for preparing antibacterial drugs in nano-level, but also provide a new thought for treating of P. gingivalis related diseases.

Porphyromonas gingivalis (P. gingivalis); Escherichia coli (E. coli); Staphylococcus aureus (S. aureus); Prevotella nigrescens (P. nigrescens); Tinidazole carbon quantum dots(TCDs); Metronidazole carbon quantum dots(MCDs); The transmission electron microscope (TEM); energy dispersive spectrometer (EDS); Confocal Laser Scanning Microscopy (CLSM); fluoresceine isothiocyanate (FITC); extracellular matrix (ECM); Lipopolysaccharide (LPS);

Ethics approval and consent to participate

No applicable.

Consent for publication

All authors are Consent for publication.

Availability of data and materials

All data generated or analyzed during this research are included in this manuscript.

Competing interests

The authors declare that they have no conflict of interest.

Fundings

This research was grant from the National Natural Science Foundation of China (81741147, U1404824 and U1804193), China Postdoctoral Science Foundation (2019M652533), Henan scientific and technological research projects (192102310189) and Innovation Scientists and Technicians Troop Construction Projects of Henan Province.

Author Contributions

Gaofeng Liang and Hao Shi designed this experiment and wrote the manuscript; Yijun Qi, Aihua Jing and jinghua Li and Qiwei Liu execute the experiment and Data curation; Wenpo Feng and Guangda Li revised the manuscript and gave some valuable suggestions. Shegan Gao supervised the experiment and give some valurable advice; Tian Tian validated it; Doulathunnisa Jaffar Alireview and edit the manuscript.

Acknowledgements

No applicable.

Capasso C, Supuran CT: Bacterial, fungal and protozoan carbonic anhydrases as drug targets. Expert Opinion on Therapeutic Targets 2015, 19:1689-1704.
How KY, Song KP, Chan KG: Porphyromonas gingivalis: An Overview of Periodontopathic Pathogen below the Gum Line. Frontiers in Microbiology 2016, 7.
Mikuls TR, Payne JB, Yu F, Thiele GM, Reynolds RJ, Cannon GW, Markt J, McGowan D, Kerr GS, Redman RS, et al: Periodontitis and Porphyromonas gingivalis in Patients With Rheumatoid Arthritis. Arthritis & Rheumatology 2014, 66:1090-1100.
Kuboniwa M, Amano A, Hashino E, Yamamoto Y, Inaba H, Hamada N, Nakayama K, Tribble GD, Lamont RJ, Shizukuishi S: Distinct roles of long/short fimbriae and gingipains in homotypic biofilm development by Porphyromonas gingivalis. Bmc Microbiology 2009, 9:13.
Ito R, Ishihara K, Shoji M, Nakayama K, Okuda K: Hemagglutinin/Adhesin domains of Porphyromonas gingivalis play key roles in coaggregation with Treponema denticola. Fems Immunology and Medical Microbiology 2010, 60:251-260.
Wang YQ, Jin YY, Chen W, Wang JJ, Chen H, Sun L, Li X, Ji J, Yu Q, Shen LY, Wang BL: Construction of nanomaterials with targeting phototherapy properties to inhibit resistant bacteria and biofilm infections. Chemical Engineering Journal 2019, 358:74-90.
Stepanovic S, Vukovic D, Dakic I, Savic B, Svabic-Vlahovic M: A modified microtiter-plate test for quantification of staphylococcal biofilm formation. Journal of microbiological methods 2000, 40:175-179.
Bernier SP, Lebeaux D, DeFrancesco AS, Valomon A, Soubigou G, Coppee JY, Ghigo JM, Beloin C: Starvation, Together with the SOS Response, Mediates High Biofilm-Specific Tolerance to the Fluoroquinolone Ofloxacin. Plos Genetics 2013, 9:14.
Fung HB, Doan T-L: Tinidazole: a nitroimidazole antiprotozoal agent. Clinical therapeutics 2005, 27:1859-1884.
Ingham HR, Selkon JB, Hale JH: The antibacterial activity of metronidazole. Journal of Antimicrobial Chemotherapy 1975, 1:355-361.
Xu X, Zhang K, Zhao L, Li C, Yang B: Aspirin-Based Carbon Dots, a Good Biocompatibility of Material Applied for Bioimaging and Anti-Inflammation. Acs Applied Materials & Interfaces 2016, 8:32706.
Kideog, Bae, Wei, Zheng, Ying, Ma, Zhiwei, Huang: Real-Time Monitoring of Pharmacokinetics of Antibiotics in Biofilms with Raman-Tagged Hyperspectral Stimulated Raman Scattering Microscopy.
Dominy SS, Lynch C, Ermini F, Benedyk M, Marczyk A, Konradi A, Nguyen M, Haditsch U, Raha D, Griffin C, et al: Porphyromonas gingivalis in Alzheimer's disease brains: Evidence for disease causation and treatment with small-molecule inhibitors. Science Advances 2019, 5.
Neethirajan S, Clond MA, Vogt A: Medical biofilms--nanotechnology approaches. Journal of Biomedical Nanotechnology 2014, 10:2806-2827.
Tursi SA, Tükel Ç: Curli-Containing Enteric Biofilms Inside and Out: Matrix Composition, Immune Recognition, and Disease Implications. Microbiology and Molecular Biology Reviews.
Wang Y, Kadiyala U, Qu Z, Elvati P, Altheim C, Kotov NA, Violi A, VanEpps JS: Anti-Biofilm Activity of Graphene Quantum Dots via Self-Assembly with Bacterial Amyloid Proteins. Acs Nano 2019, 13:4278-4289.
Sanchez CJ, Jr., Akers KS, Romano DR, Woodbury RL, Hardy SK, Murray CK, Wenke JC: D-Amino Acids Enhance the Activity of Antimicrobials against Biofilms of Clinical Wound Isolates of Staphylococcus aureus and Pseudomonas aeruginosa. Antimicrobial Agents and Chemotherapy 2014, 58:4353-4361.
Read TRH, Fairley CK, Murray GL, Jensen JS, Danielewski J, Worthington K, Doyle M, Mokany E, Tan L, Chow EPF, et al: Outcomes of Resistance-guided Sequential Treatment of Mycoplasma genitalium Infections: A Prospective Evaluation. Clinical Infectious Diseases 2019, 68:554-560.
Wang BL, Ren KF, Wang H, Ji J: Construction of Degradable Multilayer Films for Enhanced Antibacterial Properties. Acs Applied Materials & Interfaces 2013, 5:4136-4143.
Wang Y, Jin Y, Chen W, Wang J, Chen H, Sun L, Li X, Ji J, Yu Q, Shen L, Wang B: Construction of nanomaterials with targeting phototherapy properties to inhibit resistant bacteria and biofilm infections. Chemical Engineering Journal 2019, 358:74-90.
Stewart PS, Costerton JW: Antibiotic resistance of bacteria in biofilms. Lancet (London, England) 2001, 358:135-138.
Sanchez CJ, Jr., Mende K, Beckius ML, Akers KS, Romano DR, Wenke JC, Murray CK: Biofilm formation by clinical isolates and the implications in chronic infections. Bmc Infectious Diseases 2013, 13.
Akers KS, Mende K, Cheatle KA, Zera WC, Yu X, Beckius ML, Aggarwal D, Li P, Sanchez CJ, Wenke JC, et al: Biofilms and persistent wound infections in United States military trauma patients: a case-control analysis. Bmc Infectious Diseases 2014, 14.
Arciola CR, Campoccia D, Montanaro L: Implant infections: adhesion, biofilm formation and immune evasion. Nature Reviews Microbiology 2018, 16:397-409.
Wang B-L, Liu X-S, Ji Y, Ren K-F, Ji J: Fast and long-acting antibacterial properties of chitosan-Ag/polyvinylpyrrolidone nanocomposite films. Carbohydrate Polymers 2012, 90:8-15.
Wang B, Liu H, Sun L, Jin Y, Ding X, Li L, Ji J, Chen H: Construction of High Drug Loading and Enzymatic Degradable Multilayer Films for Self-Defense Drug Release and Long-Term Biofilm Inhibition. Biomacromolecules 2018, 19:85-93.
Cekici A, Kantarci A, Hasturk H, Van Dyke TE: Inflammatory and immune pathways in the pathogenesis of periodontal disease. Periodontology 2000 2014, 64:57-80.
Fan X, Alekseyenko AV, Wu J, Peters BA, Jacobs EJ, Gapstur SM, Purdue MP, Abnet CC, Stolzenberg-Solomon R, Miller G, et al: Human oral microbiome and prospective risk for pancreatic cancer: a population-based nested case-control study. Gut 2018, 67:120-127.
Kolenbrander PE, Palmer RJ, Jr., Periasamy S, Jakubovics NS: Oral multispecies biofilm development and the key role of cell-cell distance. Nature Reviews Microbiology 2010, 8:471-480.
Asally M, Kittisopikul M, Rue P, Du Y, Hu Z, Cagatay T, Robinson AB, Lu H, Garcia-Ojalvo J, Sueel GM: Localized cell death focuses mechanical forces during 3D patterning in a biofilm. Proceedings of the National Academy of Sciences of the United States of America 2012, 109:18891-18896.
Gurunathan S, Han JW, Kwon D-N, Kim J-H: Enhanced antibacterial and anti-biofilm activities of silver nanoparticles against Gram-negative and Gram-positive bacteria. Nanoscale Research Letters 2014, 9.
Loo C-Y, Rohanizadeh R, Young PM, Traini D, Cavaliere R, Whitchurch CB, Lee W-H: Combination of Silver Nanoparticles and Curcumin Nanoparticles for Enhanced Anti-biofilm Activities. Journal of Agricultural and Food Chemistry 2016, 64:2513-2522.
Mu H, Tang J, Liu Q, Sun C, Wang T, Duan J: Potent Antibacterial Nanoparticles against Biofilm and Intracellular Bacteria. Scientific Reports 2016, 6.
Sardi JCO, Scorzoni L, Bernardi T, Fusco-Almeida AM, Mendes Giannini MJS: Candida species: current epidemiology, pathogenicity, biofilm formation, natural antifungal products and new therapeutic options. Journal of Medical Microbiology 2013, 62:10-24.
Ishwarya R, Vaseeharan B, Kalyani S, Banumathi B, Govindarajan M, Alharbi NS, Kadaikunnan S, Al-anbr MN, Khaled JM, Benelli G: Facile green synthesis of zinc oxide nanoparticles using Ulva lactuca seaweed extract and evaluation of their photocatalytic, antibiofilm and insecticidal activity. Journal of Photochemistry and Photobiology B-Biology 2018, 178:249-258.
Liu C, Faria AF, Ma J, Elimelech M: Mitigation of Biofilm Development on Thin-Film Composite Membranes Functionalized with Zwitterionic Polymers and Silver Nanoparticles. Environmental Science & Technology 2017, 51:182-191.
Thuy-Khanh N, Lam SJ, Ho KKK, Kumar N, Qiao GG, Egan S, Boyer C, Wong EHH: Rational Design of Single-Chain Polymeric Nanoparticles That Kill Planktonic and Biofilm Bacteria. Acs Infectious Diseases 2017, 3:237-248.
Christensen IL, Sun Y-P, Juzenas P: Carbon Dots as Antioxidants and Prooxidants. Journal of Biomedical Nanotechnology 2011, 7:667-676.
Pan L, Sun S, Zhang A, Jiang K, Zhang L, Dong C, Huang Q, Wu A, Lin H: Truly Fluorescent Excitation-Dependent Carbon Dots and Their Applications in Multicolor Cellular Imaging and Multidimensional Sensing. Advanced Materials 2015, 27:7782-7787.
Liu J, Lu S, Tang Q, Zhang K, Yu W, Sun H, Yang B: One-step hydrothermal synthesis of photoluminescent carbon nanodots with selective antibacterial activity against Porphyromonas gingivalis. Nanoscale 2017, 9:7135-7142.
Namdari P, Negahdari B, Eatemadi A: Synthesis, properties and biomedical applications of carbon-based quantum dots: An updated review. Biomedicine & Pharmacotherapy 2017, 87:209-222.
Liu JJ, Li DW, Zhang K, Yang MX, Sun HC, Yang B: One-Step Hydrothermal Synthesis of Nitrogen-Doped Conjugated Carbonized Polymer Dots with 31% Efficient Red Emission for In Vivo Imaging. Small 2018, 14:10.
Han M, Zhu SJ, Lu SY, Song YB, Feng TL, Tao SY, Liu JJ, Yang B: Recent progress on the photocatalysis of carbon dots: Classification, mechanism and applications. Nano Today 2018, 19:201-218.
Liu H, Ye T, Mao C: Fluorescent carbon nanoparticles derived from candle soot. Angewandte Chemie (International ed in English) 2007, 46:6473-6475.
Tian L, Song Y, Chang XJ, Chen SW: Hydrothermally enhanced photoluminescence of carbon nanoparticles. Scripta Materialia 2010, 62:883-886.
Qian Z, Ma J, Shan X, Feng H, Shao L, Chen J: Highly Luminescent N-Doped Carbon Quantum Dots as an Effective Multifunctional Fluorescence Sensing Platform. Chemistry-a European Journal 2014, 20:2254-2263.
Castro HPS, Souza VS, Scholten JD, Dias JH, Fernandes JA, Rodembusch FS, dos Reis R, Dupont J, Teixeira SR, Correia RRB: Synthesis and Characterisation of Fluorescent Carbon Nanodots Produced in Ionic Liquids by Laser Ablation. Chemistry-a European Journal 2016, 22:138-143.
He L, Wang H, Zhang R, Li H: The regulation of Porphyromonas gingivalis biofilm formation by ClpP. Biochemical and Biophysical Research Communications 2019, 509:335-340.
Papenfort K, Bassler BL: Quorum sensing signal-response systems in Gram-negative bacteria. Nature Reviews Microbiology 2016, 14:576-588.
Roy R, Tiwari M, Donelli G, Tiwari V: Strategies for combating bacterial biofilms: A focus on anti-biofilm agents and their mechanisms of action. Virulence 2018, 9:522-554.
Koren O, Spor A, Felin J, Fak F, Stombaugh J, Tremaroli V, Behre CJ, Knight R, Fagerberg B, Ley RE, Backhed F: Human oral, gut, and plaque microbiota in patients with atherosclerosis. Proceedings of the National Academy of Sciences of the United States of America 2011, 108:4592-4598.
Ashrafi B, Rashidipour M, Marzban A, Soroush S, Azadpour M, Delfani S, Ramak P: Mentha piperita essential oils loaded in a chitosan nanogel with inhibitory effect on biofilm formation against S-mutans on the dental surface. Carbohydrate Polymers 2019, 212:142-149.
Sun YH, Qin HS, Yan ZQ, Zhao CQ, Ren JS, Qu XG: Combating Biofilm Associated Infection In Vivo: Integration of Quorum Sensing Inhibition and Photodynamic Treatment based on Multidrug Delivered Hollow Carbon Nitride Sphere. Advanced Functional Materials 2019, 29:12.
Luis Ayala-Herrera J, Abud-Mendoza C, Gonzalez-Amaro RF, Francisco Espinosa-Cristobal L, Elizabeth Martinez-Martinez R: Distribution of Porphyromonas gingivalis fimA genotypes in patients affected by rheumatoid arthritis and periodontitis. Acta Odontologica Scandinavica 2018, 76:520-524.
Sanchez MC, Romero-Lastra P, Ribeiro-Vidal H, Llama-Palacios A, Figuero E, Herrera D, Sanz M: Comparative gene expression analysis of planktonic Porphyromonas gingivalis ATCC 33277 in the presence of a growing biofilm versus planktonic cells. Bmc Microbiology 2019, 19.
Yi H, Huang D, Qin L, Zeng G, Lai C, Cheng M, Ye S, Song B, Ren X, Guo X: Selective prepared carbon nanomaterials for advanced photocatalytic application in environmental pollutant treatment and hydrogen production. Applied Catalysis B-Environmental 2018, 239:408-424.
Samanta HS, Ray SK: Controlled release of tinidazole and theophylline from chitosan based composite hydrogels. Carbohydrate Polymers 2014, 106:109-120.
Liang Z, Qi Y, Guo S, Hao K, Zhao M, Guo N: Effect of AgWPA nanoparticles on the inhibition of Staphylococcus aureus growth in biofilms. Food Control 2019, 100:240-246.
Li JH, Zhang KX, Ruan L, Chin SF, Wickramasinghe N, Liu HB, Ravikumar V, Ren JH, Duan HW, Yang L, Chan-Park MB: Block Copolymer Nanoparticles Remove Biofilms of Drug-Resistant Gram-Positive Bacteria by Nanoscale Bacterial Debridement. Nano Letters 2018, 18:4180-4187.
Kristoffersen AK, Solli SJ, Nguyen TD, Enersen M: Association of the rgpB gingipain genotype to the major fimbriae (fimA) genotype in clinical isolates of the periodontal pathogen Porphyromonas gingivalis. Journal of Oral Microbiology 2015, 7:1.
Feng XH, Zhang L, Xu L, Meng HX, Lu RF, Chen ZB, Shi D, Wang XN: Detection of Eight Periodontal Microorganisms and Distribution of Porphyromonas gingivalis fimA Genotypes in Chinese Patients With Aggressive Periodontitis. Journal of Periodontology 2014, 85:150-159.
Beikler T, Peters U, Prior K, Ehmke B, Flemmig TF: Sequence variations in rgpA and rgpB of Porphyromonas gingivalis in periodontitis. Journal of periodontal research 2005, 40:193-198.

Table 1 Gene-specific primers used to amplify the biofilm formation

Name of primer	Forward primer (5’ to3’)	Reverse primer (5’to3’)
FimA	TTGGCGGGAGCCGATTTAG	TTCCGGGGCCTGTAATTGTC
RgpA	CTGCGAGCGGTATTAGTGGT	CTACCAGCCCGTTTCCAACT
RgpB KGP	TCGGGACAAGTGTACGAACG AGCATACGAACCGGCGTATT	AACCAGTCTTGGGCTTCTCC TCGCATTGCTCTTACCA

Download PDF

Version 1

posted

You are reading this latest preprint version

Specific Antibiofilm of Carbon Quantum Dots by Destroying P. gingivalis Biofilm Related Proteins Self-assembly

Status:

Version 1

Abstract

Figures

Introduction

Experimental Section

Results And Discussion

Conclusions

List of Abbreviations

Declarations

References

Table

Status:

Version 1