Obesity model establishment and treatment
40 Male Sprague-Dawley rats (160–180g) were purchased from the Experimental Animal Center of Hebei Medical University (China), housed in groups of four and given three days to acclimate to the housing facility. Environmental conditions were a temperature of 21°C ± 2°C, humidity of 55% ± 10% and a 12:12 light: dark cycle with lights on at 07:00 and off at 19:00. Animals were housed in 600×400×300 mm cages and given access to rat maintenance food and water ad libitum. During housing, animals were monitored twice daily for health status. No adverse events were observed. The rats were divided into control group, obesity model group, BBR and metformin administration groups by simple random sampling. The rats in the control group were fed with normal diet (fat 13% kcal); the rats in other three groups were fed with HFD (fat 34% kcal, Beijing Botai Hongda Biotechnology Co., Ltd, China). After two weeks, the rats fed with HFD with obesity degree over 20% were determined to be successful in the obesity model (control group n=8, obesity model group n=8, BBR administration group n=8, metformin administration group n=8); then rats were concurrently treated with corresponding agents intragastrically as follows for two weeks: Control and obesity rats received equivalent amounts of saline solution, BBR administration group (200 mg/kg BBR), metformin administration group (100 mg/kg metformin). The dosages of BBR and metformin were adopted based on our laboratory and others previous studies[14, 18, 19]. All animals were handled in accordance with our institutional guidelines for animal care, as well as with the National Institutes of Health guidelines regarding the care and use of animals for experimental procedures. The present study was approved by the Hebei Medical University Ethics Committee for Animals. The study was conducted in compliance with ARRIVE guidelines.
Serum analysis
The levels of blood glucose (GLU), total cholesterol (TC) and triglyceride (TG) in serum were detected by automatic biochemical analyzer (Hitachi Hight-tech, Japan). Commercial enzyme-linked immunosorbent assay (ELISA) was used to evaluate serum interleukin-6 levels (Rat IL-6 EK306, MULTI SCIENCES, China), interleukin-1beta (Rat IL-1β EK301BV2, MULTI SCIENCES, China), and tumor necrosis factor-alpha (Rat TNF alpha Uncoated ELISA, Thermo Fisher Scientific, USA).
Mechanical parameters by AFM
Sensitivity measurement[20]:
Install the probe (Tipless Probe, MikroMasch, USA) on the AFM (Agilent Technologies, USA). In contact mode, after setting the parameters, the probe sensitivity (nm/V) was obtained by measuring the force curve in the culture dish base. Concurrently the force constants (N/m) of each probe were recorded.
Force vs time curve acquisition:
When the rats were anesthetized with isoflurane, the abdominal cavity of rats in each group was dissected, and the mesentery of small intestine was pulled out and fixed on the sample stage. Then the mesenteric vessel was localized by charge coupled device camera (CCD). In contact mode, the probe was driven to approach and contact the vessel. The vasomotion will affect the probe's floating, and AFM will record the real-time Force vs time curves. During the experiment, the mesentery was infused with saline regularly to keep the tissue moisture.
Analysis of BBR by network pharmacology
With BBR as the key word, 87 BBR-related targets were obtained from STITCH (http://stitch.embl.de/, ver. 5.0). We retrieved related targets for six representative obesity-related diseases in Genecards (https://www.genecards.org/), and screened the highly correlated protein targets (Relevance score ≥ five times the median). A total of 812 obesity-related targets, 412 diabetes mellitus type 2-related targets, 546 fatty liver-related targets, 1118 hypertension-related targets, 208 hypercholesterolemia-related targets, and 227 hyperglycemia-related targets were screened. After removing duplicate values, 1928 targets related to obesity-related diseases were obtained. Targets related to BBR and obesity-related diseases obtained using network pharmacology analysis. 55 duplicate targets were screened. Use cytoscape 3.8.2 software (https://cytoscape.org/) to build the network.
Determination of NO and NA production
For the EFS experiment, the vessels were mounted between two platinum electrodes placed 0.5 cm apart, and connected to a current stimulator (S48 Stimulator; Grass Instruments, USA). The tension across the vessels was recorded before and after EFS using a physiological recorder (PL3508 Power Lab biological signal acquisition system; AD Instruments).
The secondary mesenteric vessels segments (without stripping the surrounding adipose tissue) were incubated with a fluorescent probe (4, 5-diaminofluorescein, DAF-2; 2 μmol·L−1) for 45 min in organ bath. Then, the medium was collected to measure basal NO release. Subsequently, EFS was applied (frequency: 1, 2, 4, 8, and 16 Hz; cumulative stimulation; 20 s stimuli applied at 1-min intervals) and the medium was collected once more to measure NO and NA release. The fluorescence of the medium was measured using a spectrofluorimeter of microplate reader (Molecular Devices, SpectraMax i3, USA) with the excitation wavelength set at 492 nm and emission wavelength at 515 nm[21]. NA release was assessed using an NA ELISA assay kit (Human Noradrenaline ELISA Kit, Arigo biolaboratories, China), followed by measurement of absorbance using a microplate reader.
The fresh secondary mesenteric vessels stabilized in K-H (30 min, 37℃), then stained with DAF-2 (10-5 M) and washed 2×15 min in K-H, then fixed in 4% paraformaldehyde. Finally, the tissue was observed under fluorescence microscope (Leica Microsystems, DMI4000B, Germany)[6].
Histomorphology and immunohistomorphology
4% paraformaldehyde-fixed and paraffin-embedded tissue (secondary mesenteric vessels without stripping the surrounding adipose tissue) sections were cut into 5 μm thickness and stained with hematoxylin and eosin (H&E), Masson’s trichrome and Immunohistochemical staining with standard procedure, respectively. Rabbit anti-rat eNOS (1:100; BD Transduction Laboratories, USA) and rabbit anti rats iNOS (1:100; Arigo biolaboratories, China) were used to Immunohistochemical.
The real-time PCR assays for eNOS
TRizol reagent (Servicebio, China) was used to extract RNA from PVAT. Total RNA was retrotranscribed to synthesize cDNA with the help of verso DNA synthesis Kit (Thermo Fisher Scientific, USA). The primers used for rat eNOS were 5’ GGTATTTGATGCTCGGGACTGC 3’ and 5’ GTGATGGCTGAACGAAGATTGC 3’, and GAPDH as a reference gene. 2-ΔΔCt method was used to calculate the relative fold change[22].
Statistics
Analyses of no imaging data were carried out using SPSS 21.0 statistical software (International Business Machines Corporation, USA). The differences among multiple groups were analyzed using ANOVA (one-way analysis of variance), followed by LSD test. For all tests, the level of significance was set at P<0.05.