Animal models
Forty male Sprague Dawley (SD) rats with body weight of 180–220 g were bought from Sipford Biotechnology Co., LTD and raised in SPF environment of light cycle 12h / 12h (light on time) and relative humidity 60%. All the rats were free for drinking water and food for 3 days and then randomly divided into 4 groups based on body weight: normal group, IBS group, abdominal massage group and abdominal massage + ketotifen treatment group. IBS rat model was constructed as described before[8]. The fasted rats were anesthetized and enema was administered with acetic acid (4%, 1 mL/ rat). The colon was then irrigated with 1 mL phosphate buffered saline (PBS) to dilute acetic acid. Normal group was given 1 mL PBS. Abdominal massage was performed in Guan Yuan, Zhongwan acupuncture points about once a day for 5 minutes in 14 days. Animal experiments were conducted in accordance with Guidelines for the Care and Use of Laboratory Animals developed by the National Institutes of Health. All the animal experiments obtained the approval of the ethics committee.
Histological Assessment and Mast Cell Counts
Tissue samples were fixed in 4% paraformaldehyde, dehydrated, transparent, waxed, and embedded conventionally. Continuous sections were made with a thickness of 5μm and a distance of 30μm. Toluidine blue staining was performed after routine dewaxing, and pictures were taken under high power microscope. The number of MC was counted with ImageJ software.
RT-qPCR
Tissue RNA was extracted with Trizol and then synthetized reversely into cDNA. Realtime PCR was performed with SYBR Premix Ex Taq kit (TaKaRa). Primers used in this study were listed below: GAPDH-F: CGAGATCCCTCCAAAATCAA; GAPDH-R: TTCACACCCATGACGAACAT; TRPV1-F: CGCGGCGTGGGGAAAGACAT; TRPV1-R: CCTTCGGCTGCGGCGTGAT.
Western Blot
An equal amount of protein samples were added into polyacrylamide gel for electrophoresis, followed by semi-dry membrane transfer. Milk was used to block nonspecific antigens before the incubation of anti-TRPV1 antibody (1:500), anti-PAR2 antibody (1:400), anti-PKCε antibody (1:1000), anti-PAR2 antibody (1:500), anti-PIP2 antibody (1:400) (abcam, USA) followed by HRP secondary antibody, and color imaging was performed after inoculation with DAB chromogenic kit (abcam, USA). Grey value was analyzed with ImageJ software and normalized to GAPDH or β-actin.
Immunohistochemistry staining
Paraffin embedded tissues were sectioned continuously, and the tissue sections were dehydrated with gradient alcohol solution and sealed with 3% H2O2. Then the primary antibody of tryptase (Abcam, USA) was incubated before the HRP-second antibody incubation. Diaminobenzidine solution was added onto the tissue sections, and the distribution of tryptase was observed under a microscope.
Immunofluorescence staining and confocal laser scanning
The rats were anesthetized, the colon was exposed, and 10 ~ 15 points were taken from the colon-bladder level to the oral cavity about 6cm away. Fluorescent dye 1,1 '-bis (octaneyl)-3,3,3',3 '-tetramethylindole carbonyl anthocyanin perchlorate (DiI, InvitrogenTM, DiI) was injected into each point (Thermo Fisher Scientific Inc.) . In order to prevent dye leakage and contamination of adjacent organs, the injection needle was kept for 1min, and each point was cleaned with 0.9%NaCl solution after injection. One week after DiI injection, the small intestine tissues were quickly separated, fixed in 4% paraformaldehyde solution for 6-8h, and precipitated in 30% sucrose solution at 4℃. The sections were sealed with 10% rabbit serum for 1h, sheep anti-rat TRPV1 polyclonal antibody (1:100 dilution) was added at 4℃ overnight, fitC-labeled rabbit anti-sheep IgG/rabbit anti-Rat IgG (H+L) Secondary Antibody, Texas Red (1:50 dilution) was added at 37℃ for 30min, Hoechst was stained with nucleation, and the slices were sealed with glycerin. Laser confocal detection was used to calculate the percentage of TRPV1 positive cells in total DiI labeled cells by randomly taking 3 sections from each paraffin block and 3 fields from each section.
Transmission electron microscopy (TEM)
Briefly, the tissue mass was fixed with 2.5% glutaraldehyde, phosphate buffer preparation for 2 hours or longer and then rinsed with 0.1M phosphoric acid rinse solution before fixed 1% osmium solution. The mass was then dehydrated infiltrated and embedded. After section, the slice was stained with citrate before electron microscope observation.
Statistical Analyses
Data were presented in means ± Standard Deviation. GraphPad Prism 8 software was used for statistical analyses and photograph. Significance of P value was identified with two-tailed Student’s t-test.