Experimental animals and treatment.
Sixty healthy adult male specific pathogen free (SPF) Wister rats (7 weeks old) weighing 200–250 g were purchased from Hubei Province Laboratorial Animal Center (Hubei, China). All the experiments were conducted in accordance with the guide for the Care and the Use of Laboratory Animials and were approved by the Laboratory Animal Ethics Committee of Tianjin First Centre Hospital (Tianjin, People’s Republic of China [PRC]). The quality of included studies was assessed by using Animal Research:Reporting in Vivo Experiments(ARRIVE) guidelines. The rats were housed in the departmental animal house and kept under controlled lighting conditions (light: dark, 12 h: 12 h) with an ambient temperature of 22 ± 2 °C, relative humidity of 40%-60%, and free access to food and water. All of the rats were maintained for 7 days prior to the experimental procedures and then randomly assigned to six groups (n = 10 rats per group): the normal group, rats in this group did not undergo any kind of processing; the sham operation group, rats in this group underwent surgical manipulation, exposure of the renal artery without ligating the left anterior descending coronary artery (LAD), and treatment of the vessel with 0.9% saline; the I/R group, the LAD was ligated as described below and reperfused for 1 week, then laparotomy was performed to expose the renal artery, which was treated with 0.9% saline; the RDN group, rats in this group underwent surgical manipulation without ligating the LAD, then laparotomy was performed to expose the renal artery and phenol applied to the vessel for chemical ablation; the I/R + RDN group, the rats in this group underwent surgical manipulation with ligation of the LAD and reperfusion, then 1 week later laparotomy was performed to expose the renal artery and phenol applied to the vessel for chemical ablation; the I/R + ARNI group, the rats in this group underwent surgical manipulation with ligation of the LAD and reperfusion, and then administered oral ARNIs (60 mg/kg/day) for 2 weeks until killed. The doses used in the experiment were based on a previous study [24]. We found no significant differences in breed, body weight, age, or sex among the six groups. All rats were sacrifificed using an i.p. injection of an overdose of pentobarbital sodium.
I/R injury procedures.
The I/R model was established similar to a previous study [25]. Briefly, the rats were anesthetized using an R540 series anesthetic machine (RWD Life Science, Shenzhen, China) and fixed in a supine position for endotracheal intubation using a small animal respirator at the rate of 60 breaths/min and 1:1 suction ratio (R415, RWD, China). After removing the hair, a small incision was made in the left thoracic cavity. We opened the chest carefully and exposed the heart. The LAD was ligated using 6 − 0 silk sutures with a section of PE-10 tubing placed over the LAD for 30 min. The myocardium turned white, and their condition was confirmed by ST segment elevation in lead II of the electrocardiogram (ECG; Fig. 1). After the myocardial ischemia appeared to be successful, we released the ligature and closed the chest. The rats were placed in a cage with clean bedding, and all animals were given penicillin (80,000 u) for 3 days.
RDN procedures.
One week after ligation surgery, RDN and sham surgery were performed as described previously [26]. First, we used the R540 series anesthetic machine (RWD Life Science, Shenzhen, China), intubated, and ventilated using a rodent ventilator. Next, we exposed both kidneys. After isolating the surrounding connective tissue and periadventitial fat, we identified the renal arteries and veins. All visible nerves were severed bilaterally. We carefully painted the renal vessels vessel with phenol (10% phenol in 95% ethanol) using a cotton swab for 2 min to destroy the remaining nerves. The rats in the sham group were painted with 0.9% saline without destruction of the bilateral renal nerves.
ARNI procedures.
One week after reperfusion, the rats in one subgroup were fed ARNIs (60 mg/kg) for 2 weeks and then sacrificed. The hearts and serum were collected and preserved at -80 °C.
Echocardiography.
Two-dimensional echocardiography (DP-50ev, mindray, China) was performed 1 week after I/R (baseline level) and 2 weeks after RDN or ARNI treatment (3 weeks after I/R). Left ventricular end-diastolic diameter (LVDd), left ventricular end-systolic diameter (LVSD), left ventricular ejection fraction (LVEF), and left ventricular fractional shortening (LVFS) were chosen for analysis. The heart rate (HR) and blood pressure were monitored at the same time. A four channel physical recorder (BL-420F systems, Chengdu Technology and Market, China) was used to monitor the ECG signals.
Enzyme immunoassay of NE, Ang II, and ALD.
After 3 weeks of reperfusion, blood samples were collected and centrifuged for 30 min at 3000 g. Myocardial tissue was also collected and centrifuged for 10 min at 5000 g. The supernatant was stored at -80 °C until enzyme-linked immunosorbent assay (ELISA). The levels of Norepinephrine (NE), Ang II, and aldosterone (ALD) were determined using commercial ELISA kits (Wuhan Elabscience Biotechnology Co., Ltd, Wuhan, China) following the manufacturer’s guidelines.
2,3,5-Triphenyltetrazolium chloride (TTC) staining.
At the end of the reperfusion, the rats were sacrificed immediately for TTC staining. The hearts were removed and washed with physiological saline solution. The myocardial tissues were frozen at -20 °C for 20 min and sliced into 2-mm-thick sections. After incubation with 1% TTC solution (Beyotime, Shanghai, China) at 37 °C for 15 min, each section was photographed. The infarct area was stained white, and the non-infarct area was stained red.
Hematoxylin-eosin (HE) staining.
The myocardial tissues were collected and fixed in 10% formalin for 24 h. Next, the tissues were dehydrated, embedded, and cut into 5-µm-thick sections by a slicing machine (Leica Microsystems, Germany). The slides were baked in an oven at 60 °C for 3 h and stained with HE. We used an optical microscope (BX53, Olympus, Japan) to observe the sections.
TUNEL staining.
Three weeks after reperfusion, the rats were sacrificed. The myocardial tissue sections were used for terminal deoxynucleotidyl transferase–mediated dUTP nick end labeling (TUNEL) using an In Situ Apoptosis Detection Kit (40308ES20) according to the manufacturer’s instructions. The samples were baked in an oven at 60 °C for 3 h, washed with xylene three times (20 min each time), dehydrated with absolute ethanol for 5 min twice, followed by serial ethanol rinses (95% ethanol, 90% ethanol, and 80% ethanol each for 5 min), and the slides incubated in Proteinase K for 20 min before washing with PBS three times (5 min each time). The sections were stained with 4′, 6-diamidino-2-phenylindole (DAPI) and washed with PBS four times (5 min each time). Finally, we used a light microscope to observe the collected images.
Western blotting.
Total proteins were obtained from the myocardial tissue, which was first sheared and placed in a 2 ml EP tube and immersed in the RIPA lysis buffer with phenylmethyl sulfonylfuoride (PMSF, Beyotime, Shanghai, China). The EP tube was placed in a tissue homogenizer for 10 min and lysed for 30 min on ice. After homogenization with an ultrasonic homogenizer at 4 °C, centrifugation was performed at 12000 rpm for 5 min. The supernatant was the total protein. Next, we used the bicinchoninic acid assay kit (Beyotime, Shanghai, China) to determine the concentration of protein. After denaturation of total protein, all membranes were blocked with 5% skim milk for 120 min, and then incubated at 4 °C overnight with primary antibodies: anti-CHOP (1:500), anti-PERK (1:1000), anti-Bcl-2 (1:1000), anti-Bax (1:2000), anti-caspase3 (1:1000), anti-ATF4 (1:500), and anti-β-actin (1:500). After washing with TBST 5 times (5 min each time), all membranes were incubated with the horseradish peroxidase (HRP)-conjugated secondary antibody (1:50000) for 2 h at room temperature. The enhanced chemiluminescence (ECL) system (Applygen, Beijing, China) was applied to detect immunoreactive bands. After scanning, quantitative analysis was carried out with BandScan. The β-actin antibody was used as an internal reference.
RNA extraction and reverse transcription-polymerase chain reaction (RT-PCR).
Total RNA was extracted from myocardial tissues using the TRIzol method (BOYAO, Shanghai, China) according to the manufacturer’s instructions. The concentration and purity of total RNA were determined by measuring the OD260 and the OD260/OD280 ratio. The gene expression levels of CHOP, ATF4, PERK, and β-actin were measured by RT-PCR as described previously [27]. The expression of each mRNA was calculated using the 2 − ΔΔCt method. β-actin was used as an internal reference. The primers used in this paper are listed in Table 1.
Table 1
Primers of ATF4, CHOP, PERK and β-actin
Gene
|
Primer
|
Sequence (5’−3’)
|
PCR Products (bp)
|
ATF4
|
Forward
|
ATTCTTGCAGCCTCTTCCCT
|
213
|
Reverse
|
AGGTAGGACTCAGGGCTCAT
|
CHOP
|
Forward
|
TACTCTTGACCCTGCATCCC
|
170
|
Reverse
|
ACTGACCACTCTGTTTCCGT
|
PERK
|
Forward
|
AGTCGGTCTTTCTCAGTGGG
|
160
|
Reverse
|
CCATGTCGCAATCTGTCAGG
|
β-actin
|
Forward
|
CACGATGGAGGGGCCGGACTCATC
|
240
|
Reverse
|
TAAAGACCTCTATGCCAACACAGT
|
Statistical analysis.
SPSS 17.0 statistical software was used for the analysis of all experimental data. Groups were compared using one-way analysis of variance (ANOVA). All experimental data were expressed as mean ± SEM. P < 0.05 was considered significant.