2.1 Subjects
From 2008 to 2018, 15 patients (from 7 unrelated families), who presented joint hypermobility with or without other symptoms and were initially diagnosed with suspected Ehlers-Danlos syndrome or joint hypermobility syndrome (JHS), were recruited at the Hunan JiaHui Genetic Hospital. Informed consent was obtained from the patients’ families. This study was approved by the Ethics Board of the State Key Laboratory of Medical Genetics of China, Central South University (approval number: 2016102101).
Proband 4: The proband 4 was three-year-old, the big sister of the twins, who were diagnosed with rickets at birth and treated with calcium supplements at local hospital. Her symptoms gradually worsened due to irregular medication. The proband presented with joint hypermobility of the wrist (flexion activity was 180°), pectus carinatum, coccyx protruding and eversion of inferior costal border when came to our hospital. The ALP was 230 U/L (normal range: 118–390 U/L), Ca 76.6ug/ml (normal range: 54.0-81.6 ug/ml), P 1.64 mmol/L (normal range: 1.45–2.1 mmol/L), VitD3 75.21 nmol/L (normal range: 75.0-175.0 nmol/L) and BALP U/L (normal range: 0- U/L. Three ossification centers can be seen in the left wrist joint X-ray, electroneurography was normal. Her twin sister has milder symptoms than her, and we diagnosed them as JH-related disorder.
Proband 5: Proband 5 was a 28-year-old man, who presented with joint hypermobility at birth, and his fingers could be dorsiflexed close to forearms (Fig. 1.C1-C2), the joint space was large, and there was a sense of friction when moving, but the weight-bearing was not significantly affected. There were no vascular and joint malformations. The Ca was 46.07 mg/L (normal range: 54.0-81.6 ∝g/ml), X-ray showed that variation of distal ulnas was positive and the left side was obvious, suggesting that there might be impingement syndrome. He gave birth to a daughter who was found joint hypermobility after birth, and presented with dislocation of hip at the six months old, and then underwent surgery treatment due to the ineffective of conservative treatment. There were multiple patients presented with joint hypermobility, hip dislocation and slender fingers in this family, and we diagnosed them as suspected EDS.
2.2 Methods
Sangers sequencing or next-generation sequencing was used to identify their molecular etiology. Aiming at verifying the pathogenicity of the variant which was found in proband 6, expression vectors was constructed, qualitative analysis and western blot were used to determine the CHST14 mRNA levels and protein levels, respectively.
2.2.1 Mutation Analysis By Direct Sequencing
Genomic DNA was extracted from the peripheral blood cells of all the subjects. As proband 6 was clinically suspected diagnosis as Musculocontractural EDS, we sequenced all the exon and intron-exon boundaries of CHST14. Proband 7 was clinically suspected diagnosis as progeroid-type EDS (Spondylodysplastic EDS), which mainly caused by B4GALT7 or B3GALT6, so we sequenced all the exon and intron-exon boundaries of the two genes.
2.2.2 Copy Number Variants Sequencing
Proband 4 and proband 7 were present multiple system abnormalities, so we also conducted copy number variants sequencing of them. 50 ng of genomic DNA was fragmented to average size of 300 bp, and sequencing libraries were prepared as previously described[13]. Libraries were sequenced using the Hiseq2000 platform (Illumina Inc.) to generated approximately 8 million 36-bp single-end reads, representing 0.1-fold genome coverage. All the sequences were aligned to the unmasked hg19 genome using the Burrows-wheeler algorithm. The theoretical log2 value for a duplication is log2 [1.5] = 0.58 and for a deletion is log2 [0.5] =-1.0. Cutoff copy number values used to call duplications were set at > 2.8 (log2 [1.4] = 0.49), and those used to call deletions were set at < 1.2 (log2 [0.6] =-0.74).
2.2.3 Exome Capture And Sequencing
Since 2017, whole-exome sequencing (WES) has been implemented for all our patients, including proband 6 who was identified an uncertain significance variant (VUS) of CHST14 by direct Sanger sequencing. The samples underwent WES according to the manufacturer's protocols. The exomes were captured using the xGen® Exome Research Panel v1.0 (Integrated DNA Technologies) and sequenced on an Illumina Hiseq2000 (Illumina, San Diego, CA, USA) with 100-bp paired-end reads. We analyzed all the variants that meeting all of the following requirements: 1. Minor allele frequency (MAF) < 5% according to the 1000 Genomes Project, ESP6500 and the Exome Aggregation Consortium (ExAC) (http://exac.broadinstitute.org/) database; 2. Variants in introns and synonymous mutations were filtered out; 3. Predicted to be damaging by SIFT, PolyPhen_2, Mutation Taster and Human splicing Finder. Candidate variants were then confirmed by Sanger sequencing.
2.2.4 Construction Of Expression Vectors
The human wild-type CHST14 (complementary DNA, cDNA) was donated by the Han Lab of Xiamen University, the mammalian expression vector pCMV-N-HA containing an N-terminal HA tag (Beyotime, shanghai, China) was used for plasmid construction. To introduce the mutation into the WT-CHST14, the Mut Express II Fast Mutagenesis Kit V2(Vazyme Biotech, China) was used according to the manufacturer’s protocol. Site-directed mutagenesis was performed with the primers, 5′-CCGGAATTCCGGTCACTGCTGACACGCCTCCTTGGTG-3′ and 5′- CCGCTCGAGCGGATGTTCCCCCGCCCGCTGACC-3′. The constructs were confirmed by sanger sequencing.
2.2.5 Cell Culture And Transfection
Human embryonic kidney (HEK) 293 cells were cultured in Dulbecco’s modified Eagle’s medium (DMEM), which supplemented with 10% fetal calf serum (FCS). Wild-type (WT-CHST14), mutant-CHST14 (C362F) and empty-expressing vector with an HA tag were transiently transfected into HEK 293 cells by using Lipofectamine® 2000 Transfection Reagent (Invitrogen) according to the manufacturer's protocol, respectively.
2.2.6 Real-time Quantitative PCR
Total RNA was extracted from patients’ immortalized lymphoblast and cultured HEK 293 cells after 48 hours transfection using Trizol reagent (Invitrogen, Carlsbad, CA, USA) in accordance with standard procedures, and was reverse transcribed to the first strand cDNA with 1 µg of the extracted RNA in a final volume of 20 µl using RevertAid First Strand cDNA Synthesis Kit (Thermo scientific). Quantitative PCR was performed on a real-time PCR system (step one plus, ABI, USA) using an EvaGreen 2X qPCR MasterMix -ROX (abm) following the cycling conditions: 95 ℃ for 10 min followed by 40 cycles of 95 ℃ for 10 s, and 60 ℃ for 1 min. The relative standard curve method was used to analyze the expression level. The expression was normalized to Actin in the same sample and three biological repeats were measured. The real-time primer pairs for CHST14 were 5′-CCAAGGTGGCCTGCTCTAA-3′ and 5′- TCACTGCGGTGGTCCATCTT − 3′ (product length: 97 bp); The real-time primer pairs for actin were 5′-CGTCTTCCCCTCCATCGT-3′ and 5′-GAAGGTGTGGTGCCAGATTT − 3′ (product length: 184 bp).
2.2.7 Western Blot Analysis
HEK 293 cells were washed and extracted with 0.1% Sodium Dodecyl Sulfate (SDS) buffer (Sigma) containing protease inhibitor cocktail (Sigma) after forty-eight hours transfection, and then the proteins were quantitated using the BCA Protein Assay Kit (Thermo Scientific). 20 µg of total protein was subjected to 10% SDS-PAGE and transferred to a polyvinylidene difluoride (PVDF) membrane after electrophoretic. HA-tagged proteins were detected with mouse anti-HA antibody (1:1000 dilution; Beyotime).
2.2.8 Bioinformatics Analysis Of The Mutations
The possible effects of the mutations on the function and structure of protein, and likelihood of pathological damage were analyzed by tools including SIFT, Mutation taster, Polyphen-2 and Mutation Assessor.
Using the protein structure modeling tool Phyre2, we predicted the structure of the wild-type (Fig. 2.G1-G3) and mutant for the lumenal domain (residues 61–376) of CHST14 (Fig. 2.H1-H3). The structures prediction was performed using the maltose binding protein-heparan sulfate 6-o- (template:c5t0aB).