Reagents and Antibodies
All common reagents were purchased from Sigma-Aldrich, unless otherwise mentioned. The following antibodies were used : anti-Giantin (ab174655, Abcam), anti-Golgin97 (A21270, Thermo), anti-GM130 (610822, BD bioscience), anti-GRASP65 (MA5-25148, Thermo), anti-GRASP55 (10598-1-AP, Proteintech), anti-Golgin45 (PA530714, Thermo), anti-Syntaxin 5 (110053, Synaptic Systems), anti-GAPDH (KC-5G5, Kangchen Bio-tech), HRP conjugated Wheat Germ Agglutinin (WGA-HRP, 29073, biotium). Retro-2 was obtained from Sigma-Aldrich. Anti-Rabbit Alexa Fluor 488 (A21441), Alexa Fluor 568 (A10042), Alexa Fluor 647 (A21245) and anti-Mouse Alexa Fluor 488 (A21200), Alexa Fluor 568 (A10037), Alexa Fluor 647 (A21236) for immunofluorescence were obtained from ThermoFisher. All siRNA oligos were purchased from Shanghai GenePharma, China and the target sequences were as following: human Golgin45 (gggaacagtttcgtcaaga), human GRASP55 (GGCATTGGATATGGTTATT), human Gm130 (ggacaatgctgctactctacaacca), human GRASP65 (cctgaaggcactactgaaagccaat). The sequence of the non-targeting control siRNA was UUCUCCGAACGUGUCACGU.
Cell culture and treatments
HeLa (ATCC, CCL-2) and COS7 (Stem Cell Bank, Chinese Academy of Sciences) cells were grown in DMEM supplemented with 10% FBS (Thermo) at 37 °C. HeLa cells were authenticated by STR profiling. The authentication of COS7 is provided by Stem Cell Bank, Chinese Academy of Sciences. All cell lines were routinely tested for the mycoplasma contamination and were negative. Transfection of DNA constructs and siRNAs was performed using Lipofectamine 2000 and RNAiMAX (ThermoFisher), respectively, according to the manufacturer’s instructions.
Immunofluorescence staining
Cells grown on glass coverslips (72230-01, Electron Microscopy Sciences) in 24-well plates were fixed for 10 min with 4% paraformaldehyde (PFA), permeabilized in permeabilization Buffer (0.3% Igepal CA-630, 0.05% Triton-X 100, 0.1% IgG-free BSA in PBS) for 5 min, and blocked in blocking buffer (0.05% Igepal CA-630, 0.05% Triton-X 100, 5% normal goat serum in PBS) for 60 min. Primary and secondary antibodies were applied in blocking buffer for 1 hour. The nucleus was stained with Hoechst-33342 (sc-200908, Santa Cruz Biotechnology). Cells were washed three times with wash buffer (0.05% Igepal CA-630, 0.05% Triton-X 100, 0.2% IgG-free BSA in PBS) and twice with PBS. Coverslips were mounted using ProLong Gold Antifade Reagent (ThermoFisher). Dip coverslip in diH2O before mounting to prevent salt contamination. Images were acquired with a Zeiss LSM880 confocal microscope using a 63x Apochromat oil-immersion objective. 3D-structured illumination microscopy (SIM) imaging was acquired using Nikon N-SIM microscope.
Immunoblotting
For immunoblotting, proteins were separated by SDS-PAGE (Genscript) and transferred onto nitrocellulose membranes (Amersham). Membranes were blocked with 3% bovine serum albumin (BSA) and then probed with specific primary antibodies and then with peroxidase-conjugated secondary antibodies (Jackson ImmunoResearch). The bands were visualized with chemiluminescence (Clarity Western ECL Substrate, Bio-Rad) and imaged by a ChemiDoc Touch imaging system (Bio-Rad). Representative blots are shown from several experiments.
For detection of glycoprotein bands on blots using WGA-HRP. The blots were blocked with 3% bovine serum albumin (BSA) for 1h and were probed with WGA-HRP in PBS-T for 1h at room temperature. The blots were washed 5-times for 10min each with PBS. After five washes, the blots were visualized with chemiluminescence (Clarity Western ECL Substrate, Bio-Rad) and imaged by a ChemiDoc Touch imaging system (Bio-Rad).
Sample preparation and image acquisition for Electron microscopy/tomography
The cells were fixed in 2.5% glutaraldehyde in 0.1M sodium cacodylate buffer pH7.4 for 1 hour. They were then rinsed in 0.1M sodium cacodylate buffer, scraped and pelleted in 2% agar. Samples were trimmed and post-fixed in 1% osmium tetroxide for 1 hour, en bloc stained in 2% uranyl acetate in maleate buffer pH5.2 for a further hour, rinsed then dehydrated in an ethanol series and infiltrated with resin (Embed812, Electron Microscopy Science) and cured overnight at 60 C°. Hardened blocks were cut using a Leica UC7 Ultramicrotome, 60nm sections were collected onto formvar/carbon coated nickel grids and stained using 2% uranyl acetate and lead citrate. These were viewed FEI Tecnai Biotwin TEM at 80kV. Images were taken using Morada CCD and iTEM (Olympus) software typically at 26,000 x magnification. For electron tomography, 250nm sections were collected on formvar/carbon copper grids, 10nm gold particles added on both sides of the grids (Utrect UMC). A tomography tilt series was acquired using SerialEM software on an FEI Tecnai TF20 FEG TEM at 200kV. tomograms were reconstructed using IMOD software (University of Colorado, Boulder, CO).
ss-HRP and collagen IV secretion assays
After overnight transfection with ss-HRP plasmid, the cells were treated with DMSO or Retro-2 for 5 hours. Extracellular media were harvested and HRP activity was measured using 1-Step Ultra TMB-ELISA (ThermoFisher), according to the manufacturer’s instructions. For collagen IV secretion, COS7 cells pre-treated with DMSO or Retro-2 for 2 hours before folding block (40 °C, 3 h) without ascorbate and transport pulse condition, was later induced by shifting cells to 32 °C in the presence of 100 mg/mL ascorbate and 50µg/ml Cycloheximide for 5 hours. Extracellular media were harvested and assessed by collagen IV ELISA Kit (Novus), according to the manufacturer’s protocols.
Image processing and data presentation
Line intensity of 3D-SIM images were analyzed by Fiji software. Results are displayed as mean of results from each experiment or dataset, as indicated in figure legends. Analyses were performed with GraphPad Prism 9.0 software.