Materials and chemical
Humira® - AbbVie and Eisai
Strains and growth media
Escherichia coli DH5a (Takara Bio, Shiga, Japan) was cultured in LB medium (1% peptone, 0.5% yeast extract, and 0.5% NaCl). The A. oryzae wild-type strain, RIB40 [59] and a strain with a highly efficient gene-targeting background (niaD-sC- ∆ligD), NSlD1 [32], were used as a DNA donor. The A. oryzae strains used in this study for antibody production are listed in the Table 1. The conidia of A. oryzae were collected by growth on the PDA agar medium (Potato Dextrose Agar; Nissui Pharmaceutical, Tokyo, Japan). DPY medium containing 2% dextrin, 1% polypeptone, 0.5% yeast extract, 0.5% KH2PO4, and 0.05% MgSO4 was used for the pre-culture of transformants. Czapek-Dox (CD) medium (2% glucose, 0.3% NaNO3, 0.2% KCl, 0.1% KH2PO4, 0.05% MgSO4.7H2O, and 0.002% FeSO4.7H2O, pH 5.5) was used for selection using niaD and sC-based plasmid integration. To producing antibody, 5×DPY medium containing 10% dextrin, 5% polypeptone, 2.5% yeast extract, 0.5% K2HPO4, and 0.05% MgSO4 was used.
Plasmid construction
First, the DNA sequences of heavy chain and light chain of adalimumab were obtained from the Drugbank database (https://www.drugbank.ca/) and optimized by the codon usage table of A. oryzae. Then they were synthesized by GeneArt Gene Synthesis (Thermo Fisher Scientific, Waltham, MA, USA). The open reading frame encoded a fusion protein consisting of the a-amylase gene (amyB), a short linker including the sequence encoding for KRGGG (cleavage site for Kex2-like protease) and the mature heavy or light chain of adalimumab. Vectors pUtNAN [60] and pisCIIA [61] were used for the transformation of A. oryzae to introduce expression cassettes containing adalimumab’s heavy chain or light chain into the niaD and sC loci, respectively. These vectors contain the dextrin-inducible amyB promoter and amyB terminator, and the expression cassette was inserted at the SmaI site located at the downstream of the amyB promoter.
Transformation and expression in A. oryzae
Transformation of A. oryzae was performed as described previously [62], and transformants were selected by growth on CD minimal agar medium. Transformants were transferred to a new selective medium twice, and the colony PCR using KOD FX Neo DNA polymerase (Toyobo, Tokyo, Japan) was applied to confirm the correct transformants.
To induce antibody production, the conidia of A. oryzae transformants were inoculated in 5×DPY liquid medium (pH 8.0) with 1×107 conidia per 100 ml. After incubation at 30°C for 1-7 days at 150 rpm, the culture supernatant was collected by filtrating with Miracloth for further analysis.
Quantification of antibody
The IgG concentration in the sample was measured by standard ELISA process using goat anti-Human IgG (Southern Biotech, Birmingham, AL, USA) for the capture step. The standard curve was built with the Human IgG isotype control (Genway, San Diago, CA, USA). Goat anti-Human IgG-AP (Southern Biotech) was used for IgG detection. The results were read at the absorbance 405 nm by using TriStar2 LB942 Multimode Reader (Berthold Technologies, Bad Wildbad, Germany).
Antibody detection
The sample was mixed with an approximate volume of 5× sample loading buffer [250 mM Tris-HCl (pH 6.8), 10% SDS, 50% glycerol, 0.025 % bromophenol blue, 250 mM dithiothreitol (DTT); without DTT in case of non-reducing condition) and subjected to sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE). Either the gels were stained for protein with Coomassie Brilliant Blue (Nacalai, Kyoto, Japan) or the proteins were transferred to membrane Immobilon-P membranes (0.45 µm; Merck Millipore, Tokyo, Japan) by Western blotting. Anti-IgG (H+L chain) (Human) pAb-HRP (Medical & Biological Laboratories CO., LTD, Nagoya, Japan) was used for detection by Western Lightning Plus system (PerkinElmer, Waltham, MA, USA). The target protein bands were visualized through luminescent image analyzer (LAS-4000 mini; Fujifilm, Tokyo, Japan).
Purification
The supernatant of A. oryzae transformant was applied to Protein A SepharoseTM 4 Fast Flow system (GE Healthcare, Chicago, IL, USA) at room temperature. The antibody purification was performed by the instruction of the manufacturer with phosphate-buffered saline (PBS) as the equilibrating and washing buffers. The target protein was eluted with 0.1 M citric acid (pH 3.5) and 1 M Tris-HCl (pH 9.0) was quickly added to neutralize the eluted fraction for preserving the antibody activity.
To achieve higher purity, the antibody sample was subsequently performed by size-exclusion chromatography (SEC). Firstly, the Protein A-purified sample was collected and concentrated to proper volume by using Vivaspin Turbo ultrafiltration spin column 50K (Sartorius Lab, Göttingen, Germany). Secondly, the concentrated sample was loaded to the HiLoadTM 26/60 SuperdexTM 200 prep grade (GE Healthcare) in the ÄKTA purifier chromatography system at 4oC. The flow rate was maintained at 2 ml/min with PBS buffer (pH 7.4).
Deletion of Aooch1 gene in A. oryzae by CRISPR/Cas9 system
To delete the target gene, the genome-editing plasmid together with a circular donor DNA plasmid was generated as described by Katayama et al. [60]. The sequence GTGGTTCCAGACGACACCCA in the middle of Aooch1 gene was selected to make the sgRNA cassette with U6 promotor. The genome-editing plasmid was created by introducing the sgRNA expression cassette to the pRGE-gRT6 plasmid [60] at the SmaI cutting site. Meanwhile, the 1 kb fragments of upstream and downstream of Aooch1 gene (gene ID AO090120000208) were amplified and joined together. The flanking sequences were inserted into the pUC19 linearized vector (Takara Bio) to create the donor plasmid. Both of the plasmids were applied to transformation using the NSlD-ΔP10-derived strain producing adalimumab as mentioned above.
N-glycan analysis
For Glycopeptidase F (Takara Bio) treatment, 10 μl of protein sample was mixed with 2.5 μl of Denatured buffer with 0.2 M 2-mercaptoethanol and heated at 100oC for 3 min. Stabilizer solution (5 μl) was added and then mixed with 5.5 μl of distilled water. The reaction was carried by adding 2 μl (1 mU) of Glycopeptidase F and incubating at 37oC for 15-20 hours.
After SDS-PAGE, the gel containing the heavy chain was excised and subjected to in-gel digestion with trypsin. The generated peptides were extracted and incubated with Peptide-N-Glycosidase F (New English BioLabs, Beverly, MA, USA) at 37oC for 16 hours. The released N-glycans were purified and labelled with 2-aminopyridine (PA) using BlotGlyco (Sumitomo Bakelite, Tokyo, Japan) according to the manufacturer’s instructions. The PA-labeled N-glycan was analyzed by high-performance liquid chromatography (HPLC) using a size-fractionation column (TSKgel Amide-80, 4.6 × 250 mm, Tosoh, Tokyo, Japan) according to the method described by Chiba et al. [24].
Enzyme-linked immunosorbent assay (ELISA)
The binding activity of antibody to its antigen, recombinant human TNFα (BioLegend, San Diego, CA, USA), was measured by using 96-well Nunc MaxiSorpTM Flat-Bottom plate (Thermo Fisher Scientific). First, 100 μl TNFα solution was coated with a concentration of 100 ng/ml in sodium carbonate buffer (pH 9.6) overnight at 4 °C. The wells were washed three times with PBS-Tween solution (PBS buffer with 0.05% Tween 20) and blocked with blocking buffer (PBS-Tween containing 5% skim milk) at room temperature for 1 hour. After washing three times with the PBS-Tween solution, 100 μl of adalimumab sample in serial dilution was added to each well and incubated at room temperature for 1 hour. Then, the wells were washed again three times with PBS-Tween solution and incubated with 1:8000-diluted Anti-IgG (H+L chain) (Human) pAb-HRP antibody at room temperature for 1 hour. The plate was washed four times with PBS-Tween solution and incubated with 100 μl ELISA POD Substrate TMB Solution (Nacalai) at room temperature. The reaction was stopped by adding an equal volume of 1 M H2SO4, and the absorbance was measured at 450 nm using Multiskan FC microplate reader (Thermo Fisher Scientific).
Neutralization of human TNFα-induced cytotoxicity assay
The MDA-MB-468 cells were cultured into 96-well plate at a 5×104 cells/well density in D-MEM / Ham's F-12 media (Fujifilm Wako, Osaka, Japan) supplemented with 10% fetal bovine serum (Sigma Aldrich, St Louis, MO, USA), 50 µg/mL gentamycin (Nacalai), 0.1 µM 2-mercaptoethanol (Nacalai), 100 ng/ml actinomycin D (Sigma) and 20 ng/ml human TNFα (BioLegend). Subsequently, cells were incubated with three different types of anti-human TNFα antibody or human IgG isotype antibody in the range from 1 to 1000 ng/ml concentrations. After 24 hours, cell viability was analyzed using the Cell Proliferation Kit I (Roche, Mannheim, Germany). Briefly, 0.5 mg/mL methylthiazolyldiphenyl-tetrazolium bromide (MTT) labeling reagent was added in cell culture media. After 3 hours, 100 µl of the solubilization solution was added into each well, and the culture plate was incubated for 24 hours at 37℃. The absorbance of the plate was measured at 600 nm by TriStar2 LB942 Multimode Reader (Berthold Technologies).
FcγRIIIa binding assay
The human FcγRIIIa coding sequence was purchased from RIKEN Human cDNA Clones in Japan (clone ID: 5180561). The gene ORF sequence was amplified by PCR and cloned into the pcDNA3.1(+) expression vector. HEK-293T cells were cultured into 12-well plate in D-MEM / Ham's F-12 media supplemented with 10% fetal bovine serum, 50 µg/mL gentamycin and 0.1 µM 2-mercaptoethanol until 70–80% confluence. The complex of 10 µg Polyethylenimine (Sigma) and 1.5 µg of pcDNA3.1- human FcγRIIIa or pcDNA3.1 empty vector in serum-free media was gently added into cell culture media. After 24 hours, expression of human FcγRIIIa was confirmed by staining of the PE anti-human FcγRIIIa antibody (BioLegend) in the SA3800 Spectral Analyzer (Sony Biotechnology, San Jose, CA, USA). After aspiration of culture media of transfected cells, three different types of 15 µg/ml anti-human TNFα antibody and 40 ng/ml recombinant human TNFα in serum-free D-MEM / Ham's F-12 media were added into cells. At 3 hours after incubation, these cells were harvested and stained by the APC anti-human light chain kappa antibody (BioLegend). Antibody-binding cells were detected by the SA3800 Spectral Analyzer.