Oversight
The index patient and children of the control group were participants in the Leipzig Adipose Tissue Childhood30 (NCT02208141) and the Leipzig Obesity Childhood (NCT04491344) cohorts13. Children and guardians provided informed consent. The studies were approved by the Ethics Committee of the University of Leipzig (265/08, 007/04).
Clinical data, evaluation of eating behavior and energy expenditure
Height was measured to the nearest of one millimeter using a rigid stadiometer. Weight was measured in underwear to the nearest of 0.1 kg using a calibrated scale. BMI and height were referenced to sex and age according to current guidelines31 and are given as standard deviation scores (SDS). Children were categorized into overweight (1·28 < BMI SDS ≤ 1·88) or obese (BMI SDS > 1.88) as recommended by the German Working Group for Pediatric Obesity Consensus Guideline32.
Blood parameters were measured by standard laboratory procedures in the Institute of Laboratory Medicine of the University of Leipzig, Germany.
Eating behavior was assessed by self-reports using validated questionnaires. The Eating Disorder Examination-Questionnaire (EDE-Q)33,34 was used to assess eating disorder psychopathology regarding the subscales restraint, eating concern, weight concern, shape concern, and behavioral features such as binge-eating episodes. Scores from the patient were compared to a reference population of 1,354 women younger than 44 years of age35. Scores from the father were compared to a reference population of 1,166 men between 44–64 years of age35.
The Dutch Eating Behavior Questionnaire (DEBQ)36 evaluates emotional eating, external eating and restraint using sum scores from Likert scales. Results from the patient were compared to a reference population of 1,394 women between 14–94 years of age36.
Resting energy expenditure of the patient was examined at the age of 15 years following an overnight fast using an indirect calorimeter (Quark RMR, Cosmed Germany) according to the manufacturer’s protocol and expected metabolic rate was calculated according to her age, sex, height, and body mass.
Isolation and cultivation of SVF cells from adipose tissue
Subcutaneous adipose tissue (AT) samples were obtained from children undergoing bariatric or elective orthopedic surgery as previously described30,37. Briefly, AT was washed in phosphate-buffered saline (PBS) (Invitrogen) and minced. Adipocytes and stromal vascular fraction (SVF) cells were separated by digestion with a final concentration of 250 units/mL collagenase IV (Sigma-Aldrich) with subsequent processing through a nylon mesh with 400 µm pore size to remove connective tissue and centrifugation (800 x g, 5 min). Isolated adipocytes and a part of the SVF were frozen in liquid nitrogen for later RNA isolation. The remaining SVF pellet was re-suspended in PBS and filtered through a nylon mesh with 30 µm pore size and centrifuged again. Remaining erythrocytes were removed by incubation of the SVF cells in erythrocyte lysis buffer (0.154 M NH4Cl (Sigma-Aldrich), 0.01 M KHCO3 (Merck KGaA), 0.1 mM EDTA (Sigma-Aldrich)). SVF cells were frozen in liquid nitrogen in Dulbecco's Modified Eagle Medium/Ham F-12 culture medium (DMEM/F-12) (Life Technologies, Karlsruhe, Germany) medium containing 10% fetal bovine serum (FBS) (Biochrom GmbH) and 10% dimethyl sulfoxide (Sigma-Aldrich). Cells were thawed and 24 h after seeding cells were washed three times with PBS to select for adipocyte precursor cells via plastic adherence. Isolated SVF cells were cultivated in DMEM/Ham F-12 culture medium containing 10% FBS and 100 units penicillin and 0.1 mg/mL streptomycin (Sigma-Aldrich) at 37°C and 5% CO2 and passaged every 3–4 days.
Proliferation assay
For assessing proliferation and cell viability, 500 SVF cells were seeded at day 49, 71, and 89 of cultivation per well in 96-well plates in 5 replicates and cultivated for 8 days. After 1 and 8 days cell viability was assessed by WST-1 assay (Roche, Applied Bioscience) according to the manufacturer’s protocol. Absorbance was measured 4 hours after addition of the WST-1 reagent. Afterwards, cells were fixed, stained with Hoechst 33342 (Sigma Aldrich, St. Louis, MO, USA) and counted using the BZ-8000 microscope (Keyence, Neu-Isenburg, Germany). Doubling time between d1 and d8 was calculated using the following formula38:
Doubling time (days) = (duration (8 days) * log10(2)) / (log10 (cell number per image d1) – log10(cell number per image d8)).
Differentiation assay
For assessing adipogenic capacity, 30,000 SVF cells at day 34, 49, 71, and 89 of cultivation were seeded per well in a 48-well dish. Cells were grown to confluence for 24 to 48 hours and differentiated according to the Poietics human adipose-derived stem cell–adipogenesis protocol (Lonza) for 8 days. Differentiated cells were fixed with Roti®-Histofix 4% (Carl Roth GmbH, Karlsruhe, Deutschland), double-stained with 10 µg/mL Nile red (Sigma Aldrich, St. Louis, MO, USA) and 40 µg/mL Hoechst 33342 (Sigma Aldrich, St. Louis, MO, USA), and analyzed using the BZ-8000 microscope (Keyence, Neu-Isenburg, Germany). The percentage of differentiated cells was calculated from the number of counted differentiated cells divided by the total number of cells within an image for a total of three images per cell line. A cell was defined to be differentiated when containing at least two lipid droplets. Additionally, the cells were stained with Oil Red O (Sigma Aldrich, St. Louis, MO, USA) solution (0.3% in 60% isopropanol) for 15 minutes and washed with H2O. Oil Red O was extracted with isopropanol and absorption was measured at 540 nm.
Bioenergetic profiling
Mitochondrial function was assessed using the Seahorse XFe24 Analyzer (Agilent Technologies) and the XF Cell Mito Stress Test Kit (Agilent Technologies) using concentrations of 2 µM oligomycin, 3 µM carbonyl cyanide-4 (trifluoromethoxy) phenylhydrazone (FCCP) and 1 µM rotenone/antimycin A. In this assay oxygen consumption rate of cells is measured on basal condition after injection of oligomycin (inhibitor of the ATP synthase), after injection of FCCP (uncoupling agent disrupting the mitochondrial membrane chain) leading to uninhibited electron flow through the electron transport chain so that the oxygen consumption reaches the maximum and after injection of rotenone and antimycin A, which fully shut down mitochondrial respiration. 15,000 SVF cells from the patient or control children were seeded into gelatine-coated wells of XFe24-plates in 3–4 technical replicates. Measurements were performed 48 hours post-transfection using XF Base Medium (Agilent Technologies) containing 2 mM pyruvate (Sigma Aldrich), 10 mM glucose (Sigma Aldrich) and 2 mM glutamine (Sigma Aldrich). Results were normalized to total protein/per well (µg) by lysing the cells in 30 µL 50 mM NaCl solution (Carl Roth) with subsequent protein quantification using the Pierce™ BCA Protein Assay Kit (Thermo Fisher Scientific).
Isolation of nucleic acids
RNA was isolated from SVF cells and reverse-transcribed as previously described39. From blood, RNA was extracted using the PAXgene® Blood RNA Tubes protocol (PreAnalytics). RNA from different human tissues pooled from several individuals were obtained from Clontech-Takara Bio (Saint-Germain-en-Laye, France). Genomic DNA was extracted from EDTA blood samples using the QIAamp DNA Blood Mini Kit (Qiagen GmbH).
Transcriptome-wide analyses
Gene expression was measured using a HumanHT-12 v4 BeadChip array (ILLUMINA) by the Core Unit for DNA technologies of the University Hospital Leipzig. The R package limma was used to perform preprocessing (i.e., background correction and quantile normalization) and differential gene expression analyses40. Fold changes were log2-transformed and p-values were adjusted for multiple testing using Benjamini-Hochberg procedure (False Discovery Rate, FDR).
qRT-PCR
TaqMan quantitative real-time polymerase chain reaction (qRT-PCR) was performed as previously described39 using the QuantStudio3 Real-Time PCR System (Applied Biosystems®) and using the qPCR™ Mastermix Plus - Low ROX (Eurogentec Deutschland GmbH) or the Takyon™ Low Rox Probe Mastermix dTTP Blue (Eurogentec Deutschland GmbH). Gene expression was quantified using a standard curve of serial dilutions from a linearized plasmid containing the target sequence or from a reference sample. Gene expressions were normalized to the expression of β-actin and TATA-box-binding protein. Table S4 lists all sequences of primers and probes and TaqMan™ Gene Expression Assays (Thermo Fisher Scientific Inc.) used for qRT-PCRs.
5’RACE PCR
5’ Rapid amplification of cDNA-ends and PCR (5’RACE PCR) was performed using the SMARTer™ RACE cDNA Amplification Kit (Clontech Laboratories, Inc.) using the agouti-signaling protein (ASIP)-specific primer 5’-TTGAGGCTGAGCACGCGGCAGGAGCAGG-3’ and the nested ASIP-specific primer 5’-CTGCGGAAGAAGCGGCACTGGCAGGAGG-3’. As template, RNA from peripheral blood leukocytes from the patient was used.
RNA sequencing and transcript analyses
RNA was isolated from SVF cells of the patient and control children 1-4 as well as from peripheral blood mononuclear cells of the patient and control 9 using TRI REAGENT™ (Sigma-Aldrich) according to the manufacturer’s instructions. RNA quantity was measured with a spectrometer (Nanodrop ND 1000), and RNA quality was analyzed on the Agilent 2100 bioanalyzer using the RNA 6000 Nano Chip (Agilent Technologies, USA). We only included RNA samples with an RIN value above 8. Indexed cDNA libraries were generated using TruSeq RNA Sample Preparation kits v2 (Illumina, USA) according to the manufacturer’s protocol. The average library size was 300 bp as determined on the Agilent 2100 Bioanalyzer with DNA 1000 Chips. The libraries were sequenced on the Illumina HiScanSQ Sequencing System (Fa Macrogen Europe).
Reads were mapped to the reference human genome (GRCh38.p13 (Genome Reference Consortium Human Build 38), INSDC Assembly GCA_000001405.28, Dec 2013) using Tophat41. Reads which did not map uniquely to a genome position were excluded. After indexing with samtools42 the mapped reads were assembled to transcripts and quantified by StringTie43,44. For Tophat, we used the ‘default’ parameters which are commonly used in most studies. StringTie parameters ‘read coverage’ (-c), ‘transcript length’ (-m) and ‘bases on both sides of a junction a spliced read has to cover’ (-a) were set to minimal values in order to avoid missing transcripts and generating a bias. The parameter ‘fraction of most abundant transcript at one locus’ (-f) was lowered from default (0.01) to 0 since correction for artifacts and incompletely processed mRNA with a 1% cutoff was performed after the comparative analysis. For all other StringTie parameters default values were used. Assembled transcripts were inspected with the Integrated Genome Viewer (Broad Institute)45,46 and samples showing a visible 3′ bias due to oligo-dT/poly-A primer selection were not included.
Due to small sizes of the exons of ITCH and ASIP coverage analyses of single exons were not possible. Instead, a de novo assembly of ITCH and ASIP transcripts was performed using StringTie. Three novel transcript variants occurred containing only the first 2 annotated exons of ITCH. The fragments per kilo base per million mapped reads for these variants and also of the ASIP transcripts were compared between the patient and the controls in both tissues.
Trio whole genome sequencing, panel sequencing and copy number variation analyses
Trio whole genome sequencing and bioinformatics analyses were performed at the DRESDEN-concept Genome Center. After ultrasonic shearing of 800 ng gDNA (LE220, Covaris) the DNA library preparation was done using the Kapa HyperPlus Kit (Roche) according the manufacturer’s instructions. After ligation with uniquely dual indexed adapters (IDT), non-ligated adaptors were removed by adding XP beads (Beckmann Coulter) in a ratio of 1:0.9. The DNA libraries were then size selected with XP beads to an average insert size of 300 bp and quantified by qPCR (LightCycler 480, Roche) and the Fragment Analyzer (Agilent). Libraries were sequenced paired end 2 x 150 bp to a coverage > 38x on a NovaSeq 6000 (ILLUMINA). Bioinformatic analysis was performed using the ILLUMINA DRAGEN pipeline (07.021.595.3.7.5).
The TruSight One Sequencing panel has been performed after enrichment with Nextera DNA Flex Pre-Enrichment LibraryPrep and Enrichment, IDT for ILLUMINA Nextera UD Indexes and the NextSeq 500/550 High Output v2 kit (300 cycles) using the ILLUMINA NextSeq 500/550. Data were analysed using the software Varvis and Varfeed (Limbus, Rostock).
Molecular karyotyping of genomic DNA has been performed by array comparative genomic hybridization using the Infinium CytoSNP-850K v1.2 BeadChip (ILLUMINA) and analysed using BlueFuse Multi (version 4.4).
Generation of luciferase reporter vectors and expression constructs
DNA sequences were cloned and propagated according to the TOPO® TA Cloning® Kit, Dual Promoter protocol and confirmed by sequencing by the Core Unit for DNA technologies of the University of Leipzig. The ITCH-ASIP gDNA fusion sequence was cloned from gDNA from the patient using the ITCH-ASIP fusion primers indicated in Table S4.
The promoter sequence of ITCH (NM031483.7) (2,868 bp) was cloned from gDNA from the patient using the primers (5’ in 3’): forward ACTGGAGCTCGAAGTGGTTTTGAAAGTACTTTGCT and reverse ACTGCTCGAGAAAGCGCAGGCGCCTGAGCGCG. ASIP (NM001672.2) and ITCH-ASIP mRNA sequences were cloned from cDNA from SVF cells of the patient using primers
ASIP: forward ACTGCCATGGGCCTCCTGGGATGGATGTCACCC,
reverse ACTGTCTAGATGGGGGCGCTCAGCAGTTGAGGC and
ITCH-ASIP: forward ACTGCCATGGAGCTGTGGTCGGGGCTCGGGAC,
reverse ACTGTCTAGATGGGGGCGCTCAGCAGTTGAGGC.
For luciferase assays the ITCH promotor was inserted upstream the luciferase reporter gene into the pGL3-Basic vector using the restriction enzymes SacI and XhoI.
For generation of modified pGL3-Basic expression vectors containing the ASIP or the ITCH-ASIP coding sequence under control of ITCH or no promoter, the luciferase reporter gene was cut out of the pGL3-Basic vector using NcoI and XbaI and the cloned mRNA sequences were inserted. Subsequently, the promoter sequence of ITCH was inserted into those vectors using the restriction enzymes SacI and XhoI.
A second independent expression vector containing the coding sequence of ASIP fused to the 5’-UTR of ITCH under control of the ITCH promoter (2.8 kbp upstream of transcription start) was generated by Taconic Bioscience GmbH, Germany as shown in Figure S5.
Luciferase assay
For luciferase reporter assays, 500,000 HEK293 cells were seeded per well (6-well dish plate) and were co-transfected 24 hours post-seeding with 1 µg of pGL3-Basic plasmids containing the firefly luciferase reporter under control of a 2,868 bp ITCH promoter sequence or no promoter, and 50 ng of pRL-CMV control plasmid containing the luciferase gene from Renilla reniformis using 3 µL Fugene HD transfection reagent (Promega). Luciferase activities were measured using the Dual-Luciferase Reporter Assay System (Promega) according to the manufacturer’s protocol 48 hours post-transfection using a CLARIOstar plate reader (BMG Labtech). Experiments were performed in technical duplicates. For normalization, the sum of firefly luciferase signal was divided by the sum of Renilla luciferase signal.
Inhibition of secretory pathway in SVF cells for immunoblotting
For inhibition of the classical secretory pathway, 800,000 SVF cells were seeded on 15-cm plates. When grown to 95% confluency, cells were treated for 24 hours with 15 mL FBS-free media containing penicillin, streptomycin, 0.1% bovine serum albumin (Invitrogen) 5 µg/mL brefeldin A (solved in dimethyl sulfoxide (DMSO), BioLegend), and 2 µM monensin (solved in 70% ethanol, BioLegend). Medium containing the same volume of DMSO and 70% ethanol was used as a negative control.
Patient-derived induced pluripotent stem cell (iPSC) generation and pluripotency analyses
The generation of induced pluripotent stem cells from SVF cells isolated from adipose tissue of the patient and two control patients, 1 and 10, was performed by the iPSC Core Facility, Institute of Stem Cell Research, Helmholtz Zentrum München, Neuherberg, Germany and pluripotency was confirmed by staining of OCT4, SOX2, LIN28 and NANOG47. The iPSCs were cultivated on Geltrex (Thermo Fisher Scientific) coated cell culture plates in mTeSRTM1 medium (Stem CellTM Technologies) at 37 °C and 5% CO2.
Characterization of the pluripotency of patient-derived induced pluripotent stem cells (iPSCs) was performed as monolayers by directed differentiation into the ectodermal48, mesodermal49 and endodermal50 germ layers for a period of 5 days and subsequent qRT-PCR analyses of marker genes for each of the germ layers47. Relative expression levels were calculated using the Delta-Delta Ct method normalized to β-actin.
Immunoblotting
For analysis of ASIP protein secretion in SVF cells from the patient and controls, the cells and the conditioned medium were harvested after 24 hours of incubation with the medium containing the secretory pathways inhibitors brefeldin A and monensin or the control medium.
For analysis of ASIP protein expression, 600,000 HEK cells were seeded per 6-well dish and were transfected 24 hours later with 2 µg plasmid using 8 µL using Fugene HD transfection reagent (Promega) per well. Medium was changed 24 hours post-transfection. Cells and supernatants were harvested 48 hours post-medium change for immunoblotting.
For the analysis of ASIP protein expression and secretion in the generated iPSC lines, the cells were grown in 6-well-plates to 100% confluence before medium was changed to 1 ml knockout DMEM with 1x MEM NEAA, 1x β–mercaptoethanol, 0.1% BSA (Albumin bovine Fraction V, Protease-free, Serva, Heidelberg, GER), 100 units penicillin and 0.1 mg/mL streptomycin, 2 mM Glutamin. After 24 hours, cells and supernatants were collected for immunoblotting
Conditioned medium was centrifuged for 5 minutes at 800 x g and the supernatant was lyophilized and re-suspended in H2O for receiving 10x concentrated conditioned medium. Cells were lysed in RIPA lysis buffer (50 mM Tris pH 7.5, 150 mM NaCl, 1% Triton X-100, 0.1% sodium dodecyl sulphate, with cOmplete™Mini Protease Inhibitor Cocktail Tablets (Roche, Sigma-Aldrich GmbH) with additional break up via QiaShredder Homogenizer Columns (Qiagen). Protein concentration of cell lysates was measured using the Pierce™ BCA Protein Assay Kit (Thermo Fisher Scientific). Equal amounts of protein or conditioned medium were resolved by 12% or 15% sodium dodecyl sulphate-polyacrylamide gel electrophoresis and ASIP was detected using an anti-ASIP antibody (PA5-77052, Invitrogen). Equal loading was confirmed by detection of β-actin using an anti-β-actin antibody (ab8227, Abcam).
CHO-K1 cell culture, transfection and ALPHAScreen cAMP assay
Chinese hamster ovary cell line CHO-K1 (ATCC CCL-61™) were obtained from ATCC and maintained at 37 °C in a humidified 5 % CO2 incubator. CHO-K1 cells were grown in Dulbecco's Modified Eagle Medium: Nutrient Mixture F-12 (DMEM/F12) supplemented with 10 % fetal bovine serum (FBS), 100 U/ml penicillin and 100 µg/ml streptomycin. Cells were split into 25 cm2-cell culture flasks (0.9 x 106 cells/flask) and the following day transfected with plasmid (total amount of DNA: 3 µg) and Lipofectamine 2000 (Thermo Fisher Scientific). Plasmids encoding human MC1R51, human MC4R52 and empty vector pcDps have previously been described.
One day after transfection cells were split into 96-well plates (2 x 104 cells/well) and 16 hours prior to the experiment, cells were serum-starved. cAMP content of cell extracts was determined by a non-radioactive assay based on the ALPHAScreen (Perkin Elmer) technology according as previously described53. In brief, stimulation with various α-MSH (Sigma Aldrich) concentrations in absence or presence of 100 nM ASIP (R&D systems) or with various concentrations of ASIP alone were performed 48 h after transfection. Reactions were stopped by aspiration of media and cells were lysed in 20 μl of lysis buffer containing 1 mM 3-isobutyl-1-methylxanthine (IBMX). From each well 5 μl of lysate were transferred to a 384-well plate. Acceptor beads and donor beads were added according to the manufacturers’ protocol. Cyclic AMP accumulation data were analyzed using GraphPad Prism version 8.4.3.
Screening for patients with ASIP mutations
20 patients with obesity and red hair color, who were previously suspected for mutations in the proopiomelanocortin gene, and one patient with obesity and red hair color from the outpatient clinic of the Hospital for Children and Adolescents, University of Leipzig were screened for genomic ITCH-ASIP fusion. The patients were recruited at the Freie Universität Berlin, Humboldt-Universität zu Berlin, Institute for Experimental Pediatric Endocrinology, Berlin, Germany (mean age: 9.4 years, female: n = 13, male: n = 7). This analysis was approved by the local ethical committee (EA2/131/11). gDNA copy numbers of the ITCH-ASIP fusion sequence were quantified using SYBR green qRT-PCR using the Maxima SYBR Green/ROX qPCR Master Mix (2x) (Thermo Fisher Scientific) and the ITCH-ASIP fusion primers (Table S4) with an input of 2 ng gDNA per reaction.
The parents of the patient were analyzed for the patient-specific tandem duplication using the ITCH-ASIP fusion primers (Table S4).
Copy numbers were normalized to copy numbers of β-actin. On each plate, samples from the patient and the father were carried along as a positive control.
Statistical analyses
Statistical analyses were performed using Student’s t-test (two-sided) in GraphPad Prism 6 (GraphPad Software, San Diego, CA). P-values <0.05 were considered statistically significant.