Materials
Dimethyl sulfoxide (DMSO, #2650), Phenylmethylsulfonyl fluoride (PMSF, #P7626), 37% paraformaldehyde (#P6148), Proteinase inhibitor (#P2714), Glycine (#67419), and horseradish peroxidase (HRP) were from Sigma-Aldrich. Non-fat milk (#P0216), RIPA lysis buffer (#P0013B), RNase A (#ST578), and RNase inhibitor (#R0102-2kU) were obtained from Beyotime. T5224 (AP-1 inhibitor) was purchased from Ape×Bio Technology (#B4664). The siRNAs used in this study were designed and synthesized by GenePharma (Shanghai, China). All chemicals and solutions were analytical reagent grade and all buffer components were endotoxin free or low endotoxin from Sigma-Aldrich, as avaliable.
Animals and ethics approval
A total of 85 healthy, non-estrus and sexually mature Duroc-Yorkshire-Landrace sows (n=85; average mass 110 kg, average age 180 d) from Zhushun Biological Technology Co. (Nanjing, China) were random selected for bilateral ovaries collection and GC culture. The sows were fed, taken care, and finally slaughtered for ovaries collection according to the corresponding animal welfare strictly. All the animal experiments in this study were approved by the Animal Ethics Committee at Nanjing Agricultural University, Nanjing, P. R. China [(SYXK (Su) 2017-0027)] and performed in accordance with the Regulations for the Administration of Affairs Concerning Experimental Animals (No.2 of the State Science and Technology Commission, 11/14/1988).
Cell culture and treatment
Fresh porcine bilateral ovaries were collected and placed in a thermos flask with 37°C PBS and transported back to the laboratory within 1 h. The collected ovaries were washed with PBS 5 times and porcine GCs were harvested from 2-5 mm non-atretic ovarian follicles by using syringe with 22-gauge needle and cultured as previously described [22]. Briefly, the isolated porcine GCs were washed with 37°C PBS containing 1% penicillin and streptomycin three times, and then seeded in cell culture plates with DEME/F12 containing 10% fetal bovine serum (FBS) in a 37°C humid atmosphere with 5% CO2. KGN cells were purchased from American Type Culture Collection (ATCC, Manassas, USA) and cultured in RPMI-1640 with 10% FBS under the same condition mentioned above. All cells used in this study were tested and found to be uncontaminated and mycoplasma-negative. For cell tranfection, Lipofectamine® 3000 transfection reagent (#L3000015, Life Technologies, Carlsbad, CA 92008 USA) was used according to the manufacturer’s instruction to transiently transfect the oligonucleotides or plasmids into the cells cultured in vitro. For T-5224 (c-JUN inhibitor) treatment, the cell culture medium was replaced with fresh medium without FBS for 8 h and T-5224 was subsequently added to a final concentration of 75 and 150 μM.
RNA isolation and qRT-PCR
After treatment with indicated times, the total RNA from porcine GCs was isolated and purified by using TRIzol regent (#15596026, ThermoFisher Scientific). The quantity and quality of the purified RNA were detected by NanoDrop 3000 spectrophotometer (Agilent Technologies, USA). The degradation and contamination of the total RNA was estimated by running on a 1.0% agarose gel, and an Agilent 2100 Bioanalyzer (Agilent Technologies, USA) was used to detect the integrity of each sample. For qRT-PCR assays, 1 μg RNA was first reverse-transcripted into cDNA by using HiScript® II Q-RT SuperMix (#R223-01, Vazyme Biotech Co., Ltd, Nanjing, China). qRT-PCR was performed as we described in our previous study [23] and the relative expression levels of interested genes were calculated through the 2-ΔΔCt approach. Data from qRT-PCR assays were normalized to the expression level of glyceraldehyde-3-phosphate dehydrogenase (GAPDH). Each group has three different samples and the experiments were performed with three independent replicates. The primers used for qRT-PCR were listed in Table S1.
Rapid amplification of cDNA ends (RACE)
The transcription start sites (TSS) of porcine ACVR1B, BMPR2, and TGFBR2 were obtained by using the Rapid Amplification of cDNA end (RACE) with SMARTer RACE 5’/3’ Kit (#634858, Clontech Laboratories, Inc, CA94043, USA) according to the manufacturer’s instruction. Briefly, 4 μg total RNA from porcine GCs was used for RACE-Ready cDNA synthesis, and the 5’-end of porcine ACVR1B, BMPR2, and TGFBR2 was amplified with gene specific primers. The gene specific anti-sense primers designed for RACE were listed as following: ACVR1B-GSP: CCAGGTCGAGAGAGGGCTCTGATGC; BMPR2-GSP: CCGACCCCGACGTGGAGAGGTCGT; TGFBR2-GSP: ATGGCCAGGTGCTCACTGAACTCCA. Then, PCR products were analyzed by electrophoresis on a 2.0% agarose gel, and the clear DNA bands were collected and purified. Finally, the purified DNA fragments were cloned into pClone007 vector and the corresponding TSSs were verified by Sanger sequencing.
Re-mapping on the pig reference genome and data re-analysis
For re-analysis of the potential targets of SMAD4, the total clean tags were checked and genome mapping was re-performed with the background of pig reference genome (Sus Scrofa RefSeq 11.1) by Top Hat v2.0. Then, the information of sequence data were converted into gene expression level. For gene expression level normalization, reads per kilobase transcriptome per million mapped reads (RPKM) method was used and RPKM ≥ 1 was settled as the threshold to determine the gene expression. The differentially expressed mRNAs (DEmRNAs) were identified with the criterion below: (i) |-log2(fold change)| ≥ 0.59 (|fold change| ≥ 1.5), (ii) P-value ≤ 0.05, and (iii) FPKM ≥ 1 in all samples.
To further evaluate the potential functions, roles, and biological processes of DEmRNAs, Kyoto Encyclopedia of Genes and Genomes (KEGG) and Gene Ontology (GO) were performed by using DAVID v6.8. The GO and KEGG terms with P-value ≤ 0.05 were considered as the significant ones. For SMAD4-mediated gene-function and protein-protein interaction (PPI) network construction, the function-known DEmRNAs and interactions between them were analyzed by STRING v11.0 database (https://string-db.org/) with the basic settings: interaction degree ≥ 1 and the minimum required interaction score ≥ 0.9 [0-1]. Then, the network was visualized using Cytoscape v3.7.2 software.
Bioinformatics analysis
The potential promoters of pig ACVR1B, BMPR2 and TGFBR2 were predicted by using Softberry (http://linux1.softberry.com/all.html) and PromoterScan (http://www-bimas.cit.nih.gov/molbio/proscan/) online software. The candidate transcription factors which potentially target ACVR1B, BMPR2 and TGFBR2 promoter and their corresponding binding motifs were analyzed by JASPAR (http://jaspar.genereg.net/) and GCBI online database (https://www.gcbi.com.cn/). The SMAD4-associated proteins (including transcription factors) were also obtained from STRING v11.0 database.
siRNAs and inhibitors
To inhibit the endogenous expression of CREB1 and SP1 in porcine GCs, three gene specific interfering RNAs (siRNAs) for each target gene were designed and synthesized by GenePharma (Shanghai, China). The siRNAs used in this study were listed in Table S2. For c-JUN inhibition, T-5224 was used and the treatment concentration (75 and 150 μM) was arranged according to the manufacturer’s instructions. The inhibitory efficiency of the siRNAs and inhibitor were detected at both mRNA and protein levels.
Plasmids construction and luciferase activity assay
To identify the core promoter of porcine ACVR1B, BMPR2, and TGFBR2, the different fragments of ACVR1B, BMPR2 and TGFBR2 promoters were amplified and cloned into pGL3-Basic reporter vector between KpnI and XhoI. To detect the effects of SMAD4 on the transcription activity of porcine ACVR1B, BMPR2, and TGFBR2, their promoters containing the wild-type SMAD4 binding sites (SBEs) were amplified and cloned into pGL3-Basic reporter vector between KpnI and XhoI. Besides, the SBEs mutant type vectors were generated by using TreliefTM SoSoo Cloning Kit (#TSV-S1, Beijing TsingKe Biotech Co., Ltd) with the wild-type plasmids as templates according to the manufacturer’s instruction. To analyze the target sites of transcription co-activators (c-JUN, CREB1, and SP1) within the promoter of porcine ACVR1B, BMPR2, and TGFBR2, their promoters containing the wild or mutant type binding elements were synthesized and inserted into pGL3-Basic reporter vector. All the recombination plasmids were verified by Sanger sequencing.
For the luciferase activity detection, cells were collected after treatment for 24 h and a Dual-Luciferase Reporter Assay System (#E1910, Pormega, Madison, USA) was performed to measure the firefly luciferase and Renilla luciferase activities following the kit’s manual. The relative luciferase activity of each sample was calculated as the activity of firefly luciferase realtive to Renilla luciferase.
Western blotting
After treatment for the indicated time, porcine GCs were collected and western blotting assays were performed as we previously described [24]. In brief, the total protein from porcine GCs were extracted by ice-cold RIPA lysis buffer with 1% PMSF, and the concentration of total protein were measured by BCA method. Then, equal amount (~15 μg) of total protein was separated on an 4-20% SDS-PAGE gel and subsequently transferred into PVDF membrane (Merck Millipore, Germany) after electrophoresis. After incubation with 5% non-fat milk at room termperature for 90 min, the membranes were incubated with primary antibodies at 4°C overnight and then with corresponding secondary antibodies for 1 h. The images were obtained after incubation with ECL reagent. The primary antibodies used here were as follows: anti-SMAD4 (1:1000, #10231-1-AP, Proteintech, Jiangsu, China), anti-ACVR1B (1:1000, #D120045, Sangon Biotech, Shanghai, China), anti-BMPR2 (1:1000, #D221406, Sangon Biotech, Shanghai, China), anti-TGFBR2 (1:800, #sc-400, Santa Cruz, USA), anti-CREB1 (1:1000, #9197, Cell Signaling Technology, USA), anti-c-JUN (1:2000, #9165, Cell Signaling Technology, USA), anti-SP1 (1:1000, #2250, Cell Signaling Technology, USA) and anti-GAPDH (1:3000, #TA802519, ORIGENE, Jiangsu, China).
Immunoprecipitation (IP) and chromatin immunoprecipitation (ChIP)
To analyze the interaction between SMAD4 and co-regulators, immunoprecipitation (IP) assays were performed. In brief, the total protein extracted from porcine GCs were incubated with 4 μg anti-SMAD4 antibody at 4°C overnight to form antibody/protein-protein complex, and then incubated with the Protein A/G magnetic beads (#LSKMAGT02, Merck Millipore) for 4 h at room temperature. The pretreatment of the magnetic beads was performed according to the manufacturer’s instructions. Then, the magnetic beads with antibody/protein-protein complex was isolated and the interested proteins were obtained after elution, and further detected by western blotting assays. Anti against IgG (Biogot, #BD0051) was used here as a negative control and 100 μL total protein were used as input.
To identify the binding elements of the interested transcription factors within the promoter of target genes, chromatin immunoprecipitation (ChIP) and ChIP-qPCR assays were conducted as previously described [25, 26]. Briefly, protein-DNA were crosslinked by 37% paraformaldehyde and 2.5 M glycine at 37°C incubator for 20 min. Then, the complexes were ultrasonic with the following settings: 40% output for 130 s (10s on and 30s off) at 4°C, and subsequently pulled down with corresponding antibodies. After de-crosslinking, the enrichment of DNA fragments were analyzed by semi-quantitative PCR or qPCR. Same like IP, IgG was used as internal control for normalization of the specific antibody ChIP signals, and the unprocessed chromatin served as the input for fold enrichment from the same sample.
Statistical analysis
Statistical analyses were performed by using GraphPad Prism v7.0 software (GraphPad software) and SPSS v20.0. All data were presented as mean±SD of three independent experiments. Comparison between two groups was performed by using a two-tailed Student’s t-test. *P<0.05 and **P<0.01 were considered as statistically significant, and the significance levels were stated in the corresponding figure legend.