Bioinformatic analysis
GEPIA online database was utilized to preliminarily analyze the differential expression of MMP11 in skin cancer tissues compared to normal ones. Overall survival analysis was performed on GEPIA based on the shared TCGA data in groups (high MMP11 and low MMP11). In addition, the overall survival analysis was also done similarly on GEPIA with groups (high EGFR and low EGFR). Furthermore, the associations between MMP11 and EGFR expression in skin cancer patients are analyzed using Pearson’s method.
Cell culture and transfection
Human epidermoid skin cancer A431 cells were purchased from ATCC, USA. The cells were cultured in DMEM with streptomycin (100 µg/ml), 10% FBS, and penicillin (100 units/ml), at 370C with 5% CO2 (Beyotime, Shanghai, China). The absolute ethanol was used to prepare the stock solution of carnosol followed by the dilution of this stock solution with the growth medium to different concentrations for further use. More specifically, 96-well plate was used to seed (5×104 cells/well) and the culture medium was added with carnosol (5, 10, 20 µM) for 24h with normal A431 cells as a control group. Meanwhile, cells were transfected with sh-MMP11 or oe-MMP11 plasmids and then were treated with 20 µM for 24h with the cells skipped the transfection and directly underwent 20µM carnosol treatment for 24h as a control group. Thereafter, EGFR inhibitor, Cetuximab (250µg/ml, Merck, USA), was added into the cell 20µM carnosol group and incubated for 48h.
Elisa assay
The cell supernatant was selected for Elisa methods to measure the protein changes in different groups of A431 cells. MMP11 ELISA Kit (Matrix Metallopeptidase 11 (Stromelysin 3), Human EGFR ELISA Kit (pY1086) (ab126440), Human EGFR (pY1045)/ total EGFR ELISA Kit (ab126437) and Human Ki67 Elisa kit(ab253221) are commercially designed by Abcam, USA. Human E-Cadherin ELISA Kit (ab233611), Human Vimentin ELISA Kit (ab173190) were used for EMT evaluation. Human Caspase 3, Casp-3 ELISA Kit (Cusabio, Shanghai, China) to detect Caspase-3 activity. The protocols were strictly followed during the detection process. All the groups were detected for three times repetitively.
RT-qPCR
TRIzol reagent (Sigma Aldrich, MO, USA) was employed for the extraction of total RNA from A431 cells and PrimeScript RT Master Mix Kit (Takara Bio, Goteborg, Germany) was used to reversely transcribed RNA into cDNA. The primers were amplified in a Step One Plus real time PCR system by using SYBR Premix Ex Taq II kit (Thermo Fisher, USA) and the primers are listed as below. MMP11, forward, 5’- GAGAAGACGGACCTCACCTACA-3’, reverse, 5’- CTCAGTAAAGGTGAGTGGCGTC-3’. β-actin, forward, 5’-CACCATTGGCAATGAGCGGTTC-3’, reverse, 5’- AGGTCTTTGCGGATGTCCACGT 3’Following conditions were used for the PCR cycling: 35 s at 950C, 50 s at 600C, 35 s at 700C (30 cycles) followed by the extension at 720C for 5 min. 1% of agarose gel was used for the analysis of reaction products and visualized by ethidium bromide. β-actin was taken as an internal control. 2-△△Ct method was used to calculate the relative expression of MMP11 in different groups. All groups were evaluated at least for three times.
Colony formation assay
6-well plate was used to seed A431 cells (1×105 cells/well) from normal group, 20µM carnosol group, oeMMP11 group followed by 20µM carnosol treatment and EGFR as well as the one treated by both 20µM carnosol and EGFR inhibitor. After 14 days of culture, the plates were dried in air and photographed. In the control and treated group, the colonies were counted by Image J Software. All the procedure was repeated for three times.
Flow cytometry (FCM) assay
A flow cytometry by Annexin-FITC/PI (BD Biosciences, CA, USA) kit was used to analyze the apoptosis induction. The cells were washed with PBS twice and deferred in binding buffer (500 µl) followed by the staining with V-FITC (5 µl), PI (5 µl) and incubated for 5 min in the absence of light. FACScan flow cytometry (LabX, VA, USA) was used to analyze stained cells using statistics of the quadrants for necrotic cell population, sorting out live, late apoptosis and early apoptosis. All the procedure was repetitive three times.
Transwell invasion experiment
Transwell chambers were prepared for this assay (Beyotime, Shanghai , China). Matrigel (Beyotime, Shanghai, China) was melt at 4℃ overnight diluted to 1mg/ml with serum-free medium on the ice. Then 100μl Matrigel was incubated for 4 h at 37℃Transwell chambers were used in this assay. Serum-free medium washed the digested cells for three times and the resultant cell suspension was added into each pore (100μl/pore). The lower chamber was added with 500μl medium which contained 20% FBS (Beyotime, Shanghai, China). After incubated for 24h, the Transwell chambers were washed using PBS for two times and fixed with 5% glutaral at 4℃. Crystal violet(0.1%) was added into the cell culture. The images were taken under the lab microscope.
Statistical analysis
Data was expressed as the mean ± SD. SPSS 19.0 (IBM, NY, USA) was employed for the data examination. One-way ANOVA followed by post-hoc analysis using Bonferroni's multiple comparisons test for the assessment among two or more groups. The general alpha is 0.05. Graphpad Prism (Graphpad Prism, CA, USA) examined the statistical analysis. All the procedure was repetitive three times.