Collection of ovarian follicles and embryos and extraction of total RNA
Various stages of AB wildtype embryos were collected at different times of development. Ovarian follicles were divided into different stages according to follicular size and morphological criteria[26] with a slight modification[21–23]. Stage I, III, IVb and V ovarian follicles were collected from 4-month old mature female AB wildtype fish between 7:00am and 8:30am (lights on photoperiod 8:30am-10:30pm). Samples were placed in 1.7mL RNase-free microcentrifuge tubes (GeneMate) containing 200 ml RNAzol (Molecular Research Center, Inc., OH. Catalog: RN 190) and homogenized immediately. Total RNA was extracted from homogenized solutions according to the manufacturer’s protocol. For each sample, cDNAs was synthesized using 2 mg total RNA and a high-capacity cDNA Reverse Transcription kit (Thermo Fisher Scientific, Waltham, Massachusetts, USA, Catalog#4368814) following the manufacturer’s instructions.
PCR amplification of adamts9
A set of PCR primer (forward: 5’-GCGGTACGCGTGGTAAAATC-3’; reverse: 5’- AGGCATGTGGACATAACGCA-3’) targeting 1181bp of 3’-UTR of adamts9 was used for PCR amplification. PCR amplification was carried out using a Taq DNA polymerase (New England Biolabs, Ipswich, Massachusetts, USA, Catalog#0273) with initial denaturation at 95°C for 2 minutes followed by 35 cycles of 30 seconds denaturation at 95°C, 30 seconds annealing at 65°C, and 60 seconds elongation at 68°C. Zebrafish eukaryotic translation elongation factor 1 alpha 1a (eef1a1a) showed stable expression in different stages of embryos and ovarian follicles, therefore was used as a housekeeping gene control. A set of PCR primers targeting 242 bp of coding region of eef1a1a (forward: 5’-AGTGTTGCCTTCGTCCCAAT-3’; Reverse:5’-CACACGACCCACAGGTACAG-3’) was used for PCR amplification. The efficiency of the PCR and authentic PCR products was confirmed by gel electrophoresis analysis. The PCR products were also cloned into pGEM-T easy vector and confirmed by Sanger sequencing. The concentrations of these plasmids were quantified on Nanodrop 2000 (Thermo Fisher Scientific, Waltham, Massachusetts, USA), serially diluted and used as DNA templates for generating standard curves described in the following paragraph.
Real-time quantitative PCR (qPCR) amplification of adamts9
The levels of adamts9 transcripts were also determined by quantitative real-time PCR (qPCR) using SYBR green dye (Invitrogen) and a CFX Connect real-time thermal cycler (Bio-Rad Laboratories, Hercules, California, USA). The qPCR reaction was conducted with initial denaturation at 950C for 3 minutes, followed by 45 cycles of 30 seconds denaturation at 950C, 30 seconds annealing at 650C, and 30 seconds extension at 720C using the specific primers (Forward: 5’- CTGTCTGCGCGGTGATTCTA − 3’; Reverse: 5’- CTCTTGCAGGGGCGTGATTA − 3’) and GoTaq G2 DNA polymerase (Promega, Madison, Wisconsin, USA). Each PCR mixture (15 ml) consisted of 7.795ml DNase free water, 3 ml 5XGoTaq buffer, 1.5ml 25mM MgCl2, 0.3ml 10 mM dNTP mix, 0.15ml 10mM forward or reverse primer, 2 ml 5X diluted cDNA, 0.03 ml 100X SYBR green dye (final concentration 0.2X), and 0.075ml Taq. The transcript levels, expressed as absolute values (copies/mg total RNA), were determined using Ct values of samples and a standard curve generated from serial known concentrations of plasmid containing the target region of adamts9. The efficiency of the PCR and authentic PCR products was further confirmed by analyses of melting curve, gel electrophoresis, and Sanger sequencing.
Adamts9 expression analyzed by adamts9 promoter driven EGFP
Detailed generation and characterization of EGFP expression driven by adamts9 promoters in zebrafish will be reported in a separate manuscript. Briefly, a 4.5-kb upstream of adamts9 start codon was cloned into pGEM-T easy vector (Promega), Sanger sequence confirmed, and then subcloned into a p5E-mcs entry vector. Multisite Gateway cloning (Invitrogen) was conducted with a 5’ entry vector containing 4.5 kb adamts9 promoter sequence, a middle entry vector containing EGFP, a 3’entry vector with stop poly A signal, and a destination vector that expresses a GFP selection marker specifically in the lens of eye[27]. In this final vector, the expression of EGFP is controlled by adamts9 promoters. Transgenic embryos with the insertion could be easily selected by the eye marker that displays green fluorescence at 48 hpf under a fluorescent dissecting microscope. About 500 nl mixture containing 20 ng/ml construct, 20 ng/ml Tol2 transposon, and phenol red indicator were microinjected into one cell stage of embryos. Multiple F0 transgenic embryos were selected based on the lens selection marker, raised to adults, crossed with AB wildtype, then produced several F1 lines. Subsequently, we established multiple F2 stable transgenic lines (Tg(adamts9:GFP)) with stable expression of EGFP in the zebrafish.
Confocal imaging and analyses of GFP expression, migration and numbers of PGCs in Adamts9 knockout
Fresh, live follicles collected from adult transgenic females (Tg(adamts9:EGFP)) were placed immediately in 15 mM HEPS buffer (pH 7.8) containing 50% L-15 medium (Fisher Scientific, #41-300-039). Follicles were pipetted up and down several times to separate individual follicles. Then, individual follicles of various developmental stages were placed on a depression glass slide and mounted in 1.2% low melting point agarose and immediately imaged by confocal microscopy.
Live transgenic embryos of various developmental stages were collected by crossing male transgenic fish (Tg(adamts9:EGFP)) with AB females. Individual embryos were placed on a depression glass slide, mounted in 1.2% low melting point agarose, and immediately imaged by confocal microscopy. Five independent F1 transgenic lines were used to confirm similar expression among all the transgenic lines.
Adamts9 knockout fish were generated and reported in our previous study[24]. Vasa is an RNA helicase expressed exclusively in primordial germ cells (PGCs)[28]. By using vasa promoter to drive EGFP expression, it is possible to visualize PGCs in zebrafish embryos with a laser confocal scanning microscope. Adamts9 knockout male fish (adamts9−/−) were crossed with Tg(vasa:EGFP). Embryos were collected, raised to adult, genotyped, and then in-crossed to obtain a transgenic line with all germ cells labeled with EGFP in Adamts9 knockout background (adamts9+/−; Tg(vasa:GFP)). This transgenic line was used for generating wildtype (+/+), heterozygote (+/-) and homozygote (-/-) embryos for confocal imaging of PGCs.
Zebrafish embryos were collected at 15, 24, 48 hpf, fixed in 10% buffered formalin for four hours at room temperature. Embryos were subsequently washed with distilled water, a PBS solution, and then increasing concentrations of methanol, before storage in 100% methanol at -20ºC until analyses. Individual embryos were mounted onto a depression glass slide in 1.2% low melting point agarose and then imaged by confocal microscopy. Distance between two most distant PGCs was determined as an indicator of PGC migration using Zen 2.6 software. The number of germ cells and gonad size were determined with aid of computer software (Imaris, Bitplane Inc, Zürich, Switzerland)