Patient information and tissue specimens
This research was approved by the Ethics Committee of Air Force Medical University. Fresh specimens of hepatocellular carcinoma were collected from 143 patients in Tang Du Hospital of Air Force Medical University (Xi 'an, China) from 2004 to 2008. Liver tumor tissue was obtained from resected tumor and confirmed by pathological examination. According to the classification guidelines of the American Joint Cancer Committee/International Alliance for Cancer Control (AJCC/UICC), liver tumor specimens were staged. Classification and histopathological classification of liver specimens are based on WHO standards.
Immunohistochemistry
As mentioned earlier, immunohistochemical staining was performed to evaluate the protein expression of NDRG2 (23). For immunohistochemistry, formalin-fixed tumor tissues were embedded in paraffin, and serial 4 mm sections were obtained by Leica microtome. For staining, tumor sections were dewaxed in toluene, rehydrated in an ethanol gradient, permeabilized in citrate buffer (pH 6.0), quenched with 3% H2O2 for 5 minutes to eliminate endogenous peroxidase activity, washed in PBS, incubated with different antibodies overnight, and then incubated with biotinylated goat anti-rat or anti-rabbit IgG antibody for 15 minutes. After washing, sections were incubated with streptavidin peroxidase, lightly stained with hematoxylin, and observed under the microscope.
Cell lines and cell culture
HepG2 and SMMC-7721 cells were purchased from Merck Millipore (USA). In the atmosphere of the incubator (5% CO2, 21% O2, and 74% N2), cells were cultured in Dulbecco's modified Eagle medium (DMEM, Invitrogen Life Technologies, CA, USA) supplemented with 10% fetal bovine serum (FBS, Invitrogen Life Technologies, Carlsbad, USA) at 37°C.
Lentivirus generation and infection
In our laboratory, the ViraPower lentivirus system of Invitrogen was used to construct the recombinant lentivirus vector. cDNAs of human NDRG2 were cloned and subcloned into vector pLenti6. The short hairpin RNA(shRNA) of anti-human NDRG2 was designed by a small interfering RNA design program, and then subcloned into the EcoR I/Age I site of the pLKO-TRC vector. The specific shRNA sequence of NDRG2 is as follows:
shNDRG2-1 forward:
5′-CCGGGAGGACATGCAGGAAATCATTCTCGAGAATGATTTCCTGCATGTCCTCTTTTTG-3′;
shNDRG2-1 reverse:
5′-AATTCAAAAAGAGGACATGCAGGAAATCATTCTCGAGAATGATTTCCTGCATGTCCTC-3′;
shNDRG2-2 forward:
5′-CGGGATCCAAAAAAGCCACCTCAAGCGTCCGTCCTAGCAACAGCAAGCTTCCTGTTGCCAGGACAGACGCCTGAGGCGGCGGTGTTTCGTCCTTTCCACAA-3'
shNDRG2-2 reverse:
5′- CCCTCGAGCCCCAGTGGAA- 3’
The sequences for the control nonsense shRNA were as follows:
control forward:
5′-CCGGAAGGTCTTGTCCTCATCAACACTCGAGTGTTGATGAGGACAAGACCTTTTTTTG-3′;
control reverse:
5′–AATTCAAAAAAAGGTCTTGTCCTCATCAACACTCGAGTGTTGATGAGGACAAGACCTT-3′.
According to the manufacturer's instructions (Invitrogen, Carlsbad, CA, USA), HEK-293T cells were transfected with lentiviral vectors of pLenti6-Cherry/NDRG2, pLKO-Scramble/NDRG2-shRNA, PAX2 and PMD2G using Lipofectamine 2000. After 48 hours, the lentivirus supernatant was collected and filtered (0.45 μm filter; Millipore, Billerica, MA, USA), and added to HepG2/SMMC-7721 cells in the presence of 2 g/ml of Oryzanol (Sigma-Aldridge, USA) or 1 g/ml of poly (amine) (Sigma-Aldridge, USA) for 6 to 8 hours. Carry out two rounds of infection. After infection, the cells that survived the treatment were selected for one week, and then the expression of NDRG2 was analyzed by protein blot.
Western blot analysis
The cells were harvested from 60 mm Petri dishes. Lysates of collected cells were prepared by lysis in 200 ml RIPA buffer (0.05 M Tris- HCl [pH 7.4], 0.15 M NaCl, 0.25% deoxycholic acid, 1% Nonidet P-40, 1 mM EDTA, 1 mM benzyl sulfonyl fluoride, 10 mg/ml aprotinin and 10 mg/ml leupeptin), which Protein concentration was measured by protein assay of bicinchoninic acid (BCA). Separated by protein SDS-PAGE and transferred to nitrocellulose membrane. The membrane was saturated with Tris buffer saline containing 0.1% tween 20 and 3% bovine serum albumin (TBST-BSA), and then detected with appropriate antibodies: NDRG2 (1:2000, Cell Signaling Technology, Danvers, MA, USA), β -actin (1:2000, Cell Signaling Technology, USA), SIRT1 (1: 1000 Cell Signaling Technology, USA), followed by incubation with a species-matching secondary antibody. The bands were detected using enhanced chemiluminescence (Pierce Rockford, IL, USA) or the Odyssey imaging system (LiCor Biosciences). The band strength was quantified by Kodak Digital Science 1D 3.0 (Eastman Kodak, New Haven, CT).
Measurement of glucose uptake, lactate production, LDH activity, and oxygen consumption rate
Cells were inoculated in 6-well plates at a density of 2 × 105 cells per well and incubated at 37°C for 24h. Glucose and lactic acid concentrations in the culture medium were measured by glucose test kit (Invitrogen) and lactic acid test kit (Nanjing Jiancheng Bioengineering, China). The harvested cells were digested with 0.25% trypsin and washed with PBS. The cell suspension was homogenized on ice. According to the manufacturer's suggestion, LDH activity was measured by colorimetric assay using a specific test kit (Solarbio, Beijing, China). The absorbance of LDH was measured at 450 nm. The LDH activity in the control group was normalized to 1.0.
Cell activity and oxygen consumption rate (OCR) were measured by a hippocampus XFe 96 extracellular flux analyzer (Hippocampus Bioscience Company). Experiment according to the manufacturer's suggestion. OCR was examined by using the Mito stress test kit of hippocampus XF cells (Hippocampus Bioscience). In short, 2×105 cells were spread on the hippocampal plate, kept overnight, and then washed with hippocampal buffer. Next, the hippocampus buffer containing oligomycin, p- trifluoromethoxy carbonyl cyanide phenylhydrazone (FCCP), and rotenone + antimycin A (Rot+AA) was injected sequentially. The results were analyzed by XF-96 wave (Hippocampus Bioscience). All experiments were repeated at least 3 times.
Statistical analysis
Chi-square test or Fisher exact test and Student t-test were used to determining the significance of differences between groups. Kaplan-Meier analysis and log-rank test were used to analyze the survival rate. The T-test method was used to compare the differences between the two groups, and the variance analysis method was used to compare the number of fibrotic nodules between the two groups. SPSS software version 16.0 (Chicago, USA) was used for statistical analysis. The significance was based on the value of P<0.05.
